Incidental Mutation 'R7606:Myo1f'
ID588330
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Namemyosin IF
SynonymsC330006B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R7606 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33555719-33607764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33576450 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 53 (V53A)
Ref Sequence ENSEMBL: ENSMUSP00000084887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372] [ENSMUST00000174695]
Predicted Effect probably damaging
Transcript: ENSMUST00000087605
AA Change: V53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: V53A

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173372
AA Change: V53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: V53A

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174695
SMART Domains Protein: ENSMUSP00000134600
Gene: ENSMUSG00000024300

DomainStartEndE-ValueType
Pfam:Myosin_head 47 98 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,036,035 probably null Het
Adat1 T C 8: 111,982,604 K196E possibly damaging Het
Aire T C 10: 78,037,933 D314G probably damaging Het
Atp11a C T 8: 12,844,427 T674I probably damaging Het
Atp8b1 T C 18: 64,555,115 D644G probably damaging Het
Bag4 A G 8: 25,769,305 S289P probably damaging Het
Bcat1 G T 6: 145,048,632 H46Q probably benign Het
Btg4 A G 9: 51,118,007 N164S probably damaging Het
Ccz1 G A 5: 144,014,808 A2V probably benign Het
Cd209g T C 8: 4,136,839 L128P probably damaging Het
Col4a2 T A 8: 11,443,571 M1380K probably benign Het
Cpox T C 16: 58,674,449 V283A probably benign Het
Dnah10 A T 5: 124,817,712 D3504V probably benign Het
Eml1 A T 12: 108,537,366 I741F probably benign Het
Fam171a2 A G 11: 102,444,176 V45A possibly damaging Het
Fem1a A G 17: 56,256,946 D13G probably damaging Het
Fkbp14 A G 6: 54,593,018 I9T probably benign Het
Golt1b G A 6: 142,392,342 G13D probably damaging Het
Heatr5b T C 17: 78,763,026 N1653D probably benign Het
Hrg A G 16: 22,951,123 M1V probably null Het
Itgb2 T A 10: 77,556,161 I356N probably damaging Het
Kcnb2 A G 1: 15,312,840 E130G probably damaging Het
Kpna2 A T 11: 106,992,058 F124Y probably damaging Het
Lyst T C 13: 13,637,475 I824T probably damaging Het
Meis2 T C 2: 116,063,320 H38R possibly damaging Het
Mknk1 T G 4: 115,877,994 I353S probably damaging Het
Mrc1 T A 2: 14,238,144 I27N probably damaging Het
Mup4 T C 4: 59,958,568 T111A probably damaging Het
Neb T G 2: 52,226,444 E994A Het
Nlrc5 T C 8: 94,477,117 M615T possibly damaging Het
Nup88 T C 11: 70,961,615 E218G possibly damaging Het
Olfr1219 A G 2: 89,075,297 probably benign Het
Olfr1513 A T 14: 52,349,963 F28I probably benign Het
Parp11 A G 6: 127,470,760 D19G probably benign Het
Parp2 A T 14: 50,820,030 T429S probably damaging Het
Pcdhb6 G A 18: 37,335,606 E527K probably damaging Het
Pde8a A G 7: 81,332,967 Y778C probably damaging Het
Pea15a T C 1: 172,200,583 probably null Het
Plcd3 A G 11: 103,076,857 Y420H probably damaging Het
Ppp1ca C A 19: 4,193,089 S85R possibly damaging Het
Pth A C 7: 113,386,243 I13S probably benign Het
Rbm27 A G 18: 42,327,513 T842A probably damaging Het
Rcbtb2 T A 14: 73,182,366 probably null Het
Rubcnl C T 14: 75,038,874 L323F probably benign Het
Ryr3 A T 2: 112,645,245 Y4539* probably null Het
Scamp3 T A 3: 89,181,218 F244I probably damaging Het
Sema4d T C 13: 51,723,622 D58G probably benign Het
Skor1 G T 9: 63,145,382 A435E probably damaging Het
Slc35a4 A G 18: 36,682,585 Y156C probably benign Het
Spryd7 T C 14: 61,540,158 T158A possibly damaging Het
Srgap3 A C 6: 112,739,376 I621S probably benign Het
Tbc1d31 A G 15: 57,951,670 E581G probably damaging Het
Tcf4 C T 18: 69,642,983 T318I probably damaging Het
Usf3 C T 16: 44,218,943 T1262M probably damaging Het
Vcam1 T C 3: 116,121,055 D316G possibly damaging Het
Vmn2r72 T A 7: 85,751,154 E229V possibly damaging Het
Zfhx2 T C 14: 55,066,663 E1288G probably benign Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0321:Myo1f UTSW 17 33593012 missense probably benign 0.31
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R0925:Myo1f UTSW 17 33578133 missense probably damaging 0.96
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1395:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6365:Myo1f UTSW 17 33586116 missense probably benign
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7266:Myo1f UTSW 17 33601694 missense probably benign
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
R7779:Myo1f UTSW 17 33578273 missense probably benign 0.27
R7853:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7884:Myo1f UTSW 17 33598296 missense probably damaging 1.00
R8507:Myo1f UTSW 17 33598018 missense probably benign 0.09
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTGGGAGAGCTAAACC -3'
(R):5'- CAGTCGATCAGCATATTCCGG -3'

Sequencing Primer
(F):5'- TTGGGAGAGCTAAACCACTAC -3'
(R):5'- GTCGATCAGCATATTCCGGTACATG -3'
Posted On2019-10-24