Mutagenetix > Incidental Mutations

Incidental Mutation 'R7606:Myo1f'

588330

Institutional Source

Beutler Lab

Gene Symbol

Myo1f

Ensembl Gene

ENSMUSG00000024300

Gene Name

myosin IF

Synonyms

C330006B10Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R7606 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33555719-33607764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33576450 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 53 (V53A)

Ref Sequence

ENSEMBL: ENSMUSP00000084887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372] [ENSMUST00000174695]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087605
AA Change: V53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: V53A

Domain	Start	End	E-Value	Type
MYSc	11	691	N/A	SMART
IQ	692	714	7.57e0	SMART
Pfam:Myosin_TH1	717	909	1.7e-51	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	973	987	N/A	INTRINSIC
low complexity region	991	1001	N/A	INTRINSIC
SH3	1044	1098	2.09e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000173372
AA Change: V53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: V53A

Domain	Start	End	E-Value	Type
MYSc	11	691	N/A	SMART
IQ	692	714	7.57e0	SMART
Pfam:Myosin_TH1	716	780	6e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174695

SMART Domains

Protein: ENSMUSP00000134600
Gene: ENSMUSG00000024300

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	47	98	1.3e-21	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	T	A	3: 60,036,035		probably null	Het
Adat1	T	C	8: 111,982,604	K196E	possibly damaging	Het
Aire	T	C	10: 78,037,933	D314G	probably damaging	Het
Atp11a	C	T	8: 12,844,427	T674I	probably damaging	Het
Atp8b1	T	C	18: 64,555,115	D644G	probably damaging	Het
Bag4	A	G	8: 25,769,305	S289P	probably damaging	Het
Bcat1	G	T	6: 145,048,632	H46Q	probably benign	Het
Btg4	A	G	9: 51,118,007	N164S	probably damaging	Het
Ccz1	G	A	5: 144,014,808	A2V	probably benign	Het
Cd209g	T	C	8: 4,136,839	L128P	probably damaging	Het
Col4a2	T	A	8: 11,443,571	M1380K	probably benign	Het
Cpox	T	C	16: 58,674,449	V283A	probably benign	Het
Dnah10	A	T	5: 124,817,712	D3504V	probably benign	Het
Eml1	A	T	12: 108,537,366	I741F	probably benign	Het
Fam171a2	A	G	11: 102,444,176	V45A	possibly damaging	Het
Fem1a	A	G	17: 56,256,946	D13G	probably damaging	Het
Fkbp14	A	G	6: 54,593,018	I9T	probably benign	Het
Golt1b	G	A	6: 142,392,342	G13D	probably damaging	Het
Heatr5b	T	C	17: 78,763,026	N1653D	probably benign	Het
Hrg	A	G	16: 22,951,123	M1V	probably null	Het
Itgb2	T	A	10: 77,556,161	I356N	probably damaging	Het
Kcnb2	A	G	1: 15,312,840	E130G	probably damaging	Het
Kpna2	A	T	11: 106,992,058	F124Y	probably damaging	Het
Lyst	T	C	13: 13,637,475	I824T	probably damaging	Het
Meis2	T	C	2: 116,063,320	H38R	possibly damaging	Het
Mknk1	T	G	4: 115,877,994	I353S	probably damaging	Het
Mrc1	T	A	2: 14,238,144	I27N	probably damaging	Het
Mup4	T	C	4: 59,958,568	T111A	probably damaging	Het
Neb	T	G	2: 52,226,444	E994A		Het
Nlrc5	T	C	8: 94,477,117	M615T	possibly damaging	Het
Nup88	T	C	11: 70,961,615	E218G	possibly damaging	Het
Olfr1219	A	G	2: 89,075,297		probably benign	Het
Olfr1513	A	T	14: 52,349,963	F28I	probably benign	Het
Parp11	A	G	6: 127,470,760	D19G	probably benign	Het
Parp2	A	T	14: 50,820,030	T429S	probably damaging	Het
Pcdhb6	G	A	18: 37,335,606	E527K	probably damaging	Het
Pde8a	A	G	7: 81,332,967	Y778C	probably damaging	Het
Pea15a	T	C	1: 172,200,583		probably null	Het
Plcd3	A	G	11: 103,076,857	Y420H	probably damaging	Het
Ppp1ca	C	A	19: 4,193,089	S85R	possibly damaging	Het
Pth	A	C	7: 113,386,243	I13S	probably benign	Het
Rbm27	A	G	18: 42,327,513	T842A	probably damaging	Het
Rcbtb2	T	A	14: 73,182,366		probably null	Het
Rubcnl	C	T	14: 75,038,874	L323F	probably benign	Het
Ryr3	A	T	2: 112,645,245	Y4539*	probably null	Het
Scamp3	T	A	3: 89,181,218	F244I	probably damaging	Het
Sema4d	T	C	13: 51,723,622	D58G	probably benign	Het
Skor1	G	T	9: 63,145,382	A435E	probably damaging	Het
Slc35a4	A	G	18: 36,682,585	Y156C	probably benign	Het
Spryd7	T	C	14: 61,540,158	T158A	possibly damaging	Het
Srgap3	A	C	6: 112,739,376	I621S	probably benign	Het
Tbc1d31	A	G	15: 57,951,670	E581G	probably damaging	Het
Tcf4	C	T	18: 69,642,983	T318I	probably damaging	Het
Usf3	C	T	16: 44,218,943	T1262M	probably damaging	Het
Vcam1	T	C	3: 116,121,055	D316G	possibly damaging	Het
Vmn2r72	T	A	7: 85,751,154	E229V	possibly damaging	Het
Zfhx2	T	C	14: 55,066,663	E1288G	probably benign	Het

Other mutations in Myo1f

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00851:Myo1f	APN	17	33581964	missense	probably benign	0.01
IGL01019:Myo1f	APN	17	33593003	missense	possibly damaging	0.93
IGL01524:Myo1f	APN	17	33579883	missense	probably damaging	1.00
IGL01744:Myo1f	APN	17	33583680	splice site	probably benign
IGL01951:Myo1f	APN	17	33598017	missense	possibly damaging	0.64
IGL02132:Myo1f	APN	17	33579971	missense	probably benign	0.10
IGL02170:Myo1f	APN	17	33578272	missense	probably benign	0.14
IGL02173:Myo1f	APN	17	33607344	missense	probably damaging	1.00
IGL02277:Myo1f	APN	17	33579861	splice site	probably null
IGL02550:Myo1f	APN	17	33588142	missense	probably damaging	1.00
IGL02550:Myo1f	APN	17	33580150	unclassified	probably benign
IGL02615:Myo1f	APN	17	33604656	missense	probably benign
IGL02801:Myo1f	APN	17	33578137	missense	probably damaging	1.00
IGL02817:Myo1f	APN	17	33604558	missense	probably benign	0.06
IGL02904:Myo1f	APN	17	33585658	nonsense	probably null
IGL03056:Myo1f	APN	17	33585600	missense	probably damaging	1.00
IGL03334:Myo1f	APN	17	33598194	missense	probably damaging	1.00
R0066:Myo1f	UTSW	17	33601703	missense	probably damaging	0.98
R0066:Myo1f	UTSW	17	33601703	missense	probably damaging	0.98
R0321:Myo1f	UTSW	17	33593012	missense	probably benign	0.31
R0375:Myo1f	UTSW	17	33601956	missense	probably benign	0.27
R0487:Myo1f	UTSW	17	33578284	missense	probably damaging	1.00
R0925:Myo1f	UTSW	17	33578133	missense	probably damaging	0.96
R1394:Myo1f	UTSW	17	33583740	missense	probably damaging	0.96
R1395:Myo1f	UTSW	17	33583740	missense	probably damaging	0.96
R1474:Myo1f	UTSW	17	33594027	missense	possibly damaging	0.77
R1760:Myo1f	UTSW	17	33586198	missense	probably benign	0.03
R1965:Myo1f	UTSW	17	33598172	nonsense	probably null
R2409:Myo1f	UTSW	17	33576667	missense	probably damaging	1.00
R2432:Myo1f	UTSW	17	33575849	missense	probably damaging	1.00
R4610:Myo1f	UTSW	17	33582332	missense	probably damaging	1.00
R4785:Myo1f	UTSW	17	33598191	missense	possibly damaging	0.95
R5239:Myo1f	UTSW	17	33601735	missense	probably benign	0.00
R5881:Myo1f	UTSW	17	33576653	missense	probably damaging	1.00
R5881:Myo1f	UTSW	17	33580285	missense	possibly damaging	0.46
R6160:Myo1f	UTSW	17	33604344	missense	probably benign
R6210:Myo1f	UTSW	17	33601070	missense	probably damaging	1.00
R6365:Myo1f	UTSW	17	33586116	missense	probably benign
R6464:Myo1f	UTSW	17	33576647	missense	probably damaging	1.00
R6532:Myo1f	UTSW	17	33575846	missense	probably damaging	1.00
R6678:Myo1f	UTSW	17	33575845	missense	probably damaging	1.00
R7241:Myo1f	UTSW	17	33579928	missense	probably damaging	0.99
R7266:Myo1f	UTSW	17	33601694	missense	probably benign
R7513:Myo1f	UTSW	17	33575814	missense	probably damaging	1.00
R7779:Myo1f	UTSW	17	33578273	missense	probably benign	0.27
R7853:Myo1f	UTSW	17	33576698	missense	probably damaging	1.00
R7884:Myo1f	UTSW	17	33598296	missense	probably damaging	1.00
R8507:Myo1f	UTSW	17	33598018	missense	probably benign	0.09
X0028:Myo1f	UTSW	17	33576438	missense	possibly damaging	0.67
X0065:Myo1f	UTSW	17	33601983	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCTTGGGAGAGCTAAACC -3'
(R):5'- CAGTCGATCAGCATATTCCGG -3'

Sequencing Primer
(F):5'- TTGGGAGAGCTAAACCACTAC -3'
(R):5'- GTCGATCAGCATATTCCGGTACATG -3'

Posted On

2019-10-24