Incidental Mutation 'R7606:Pcdhb6'
ID 588334
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Name protocadherin beta 6
Synonyms Pcdhb5B, PcdhbF
MMRRC Submission 045676-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7606 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37466913-37470491 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37468659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 527 (E527K)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
AlphaFold Q91XZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000061717
AA Change: E527K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: E527K

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 59,943,456 (GRCm39) probably null Het
Adat1 T C 8: 112,709,236 (GRCm39) K196E possibly damaging Het
Aire T C 10: 77,873,767 (GRCm39) D314G probably damaging Het
Atp11a C T 8: 12,894,427 (GRCm39) T674I probably damaging Het
Atp8b1 T C 18: 64,688,186 (GRCm39) D644G probably damaging Het
Bag4 A G 8: 26,259,333 (GRCm39) S289P probably damaging Het
Bcat1 G T 6: 144,994,358 (GRCm39) H46Q probably benign Het
Btg4 A G 9: 51,029,307 (GRCm39) N164S probably damaging Het
Ccz1 G A 5: 143,951,626 (GRCm39) A2V probably benign Het
Cd209g T C 8: 4,186,839 (GRCm39) L128P probably damaging Het
Col4a2 T A 8: 11,493,571 (GRCm39) M1380K probably benign Het
Cpox T C 16: 58,494,812 (GRCm39) V283A probably benign Het
Dnah10 A T 5: 124,894,776 (GRCm39) D3504V probably benign Het
Eml1 A T 12: 108,503,625 (GRCm39) I741F probably benign Het
Fam171a2 A G 11: 102,335,002 (GRCm39) V45A possibly damaging Het
Fem1a A G 17: 56,563,946 (GRCm39) D13G probably damaging Het
Fkbp14 A G 6: 54,570,003 (GRCm39) I9T probably benign Het
Golt1b G A 6: 142,338,068 (GRCm39) G13D probably damaging Het
Heatr5b T C 17: 79,070,455 (GRCm39) N1653D probably benign Het
Hrg A G 16: 22,769,873 (GRCm39) M1V probably null Het
Itgb2 T A 10: 77,391,995 (GRCm39) I356N probably damaging Het
Kcnb2 A G 1: 15,383,064 (GRCm39) E130G probably damaging Het
Kpna2 A T 11: 106,882,884 (GRCm39) F124Y probably damaging Het
Lyst T C 13: 13,812,060 (GRCm39) I824T probably damaging Het
Meis2 T C 2: 115,893,801 (GRCm39) H38R possibly damaging Het
Mknk1 T G 4: 115,735,191 (GRCm39) I353S probably damaging Het
Mrc1 T A 2: 14,242,955 (GRCm39) I27N probably damaging Het
Mup4 T C 4: 59,958,568 (GRCm39) T111A probably damaging Het
Myo1f T C 17: 33,795,424 (GRCm39) V53A probably damaging Het
Neb T G 2: 52,116,456 (GRCm39) E994A Het
Nlrc5 T C 8: 95,203,745 (GRCm39) M615T possibly damaging Het
Nup88 T C 11: 70,852,441 (GRCm39) E218G possibly damaging Het
Or10g3b A T 14: 52,587,420 (GRCm39) F28I probably benign Het
Or4c114 A G 2: 88,905,641 (GRCm39) probably benign Het
Parp11 A G 6: 127,447,723 (GRCm39) D19G probably benign Het
Parp2 A T 14: 51,057,487 (GRCm39) T429S probably damaging Het
Pde8a A G 7: 80,982,715 (GRCm39) Y778C probably damaging Het
Pea15a T C 1: 172,028,150 (GRCm39) probably null Het
Plcd3 A G 11: 102,967,683 (GRCm39) Y420H probably damaging Het
Ppp1ca C A 19: 4,243,088 (GRCm39) S85R possibly damaging Het
Pth A C 7: 112,985,450 (GRCm39) I13S probably benign Het
Rbm27 A G 18: 42,460,578 (GRCm39) T842A probably damaging Het
Rcbtb2 T A 14: 73,419,806 (GRCm39) probably null Het
Rubcnl C T 14: 75,276,314 (GRCm39) L323F probably benign Het
Ryr3 A T 2: 112,475,590 (GRCm39) Y4539* probably null Het
Scamp3 T A 3: 89,088,525 (GRCm39) F244I probably damaging Het
Sema4d T C 13: 51,877,658 (GRCm39) D58G probably benign Het
Skor1 G T 9: 63,052,664 (GRCm39) A435E probably damaging Het
Slc35a4 A G 18: 36,815,638 (GRCm39) Y156C probably benign Het
Spryd7 T C 14: 61,777,607 (GRCm39) T158A possibly damaging Het
Srgap3 A C 6: 112,716,337 (GRCm39) I621S probably benign Het
Tbc1d31 A G 15: 57,815,066 (GRCm39) E581G probably damaging Het
Tcf4 C T 18: 69,776,054 (GRCm39) T318I probably damaging Het
Usf3 C T 16: 44,039,306 (GRCm39) T1262M probably damaging Het
Vcam1 T C 3: 115,914,704 (GRCm39) D316G possibly damaging Het
Vmn2r72 T A 7: 85,400,362 (GRCm39) E229V possibly damaging Het
Zfhx2 T C 14: 55,304,120 (GRCm39) E1288G probably benign Het
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37,467,277 (GRCm39) missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37,468,873 (GRCm39) missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37,468,735 (GRCm39) missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37,468,507 (GRCm39) missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37,467,747 (GRCm39) missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37,468,640 (GRCm39) nonsense probably null
IGL03144:Pcdhb6 APN 18 37,467,459 (GRCm39) missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37,469,205 (GRCm39) missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37,467,585 (GRCm39) missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37,469,190 (GRCm39) missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37,468,300 (GRCm39) missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37,468,167 (GRCm39) missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37,468,387 (GRCm39) missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37,467,640 (GRCm39) missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37,468,633 (GRCm39) missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37,468,633 (GRCm39) missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37,469,284 (GRCm39) missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37,468,222 (GRCm39) missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37,468,945 (GRCm39) missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37,468,945 (GRCm39) missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37,469,193 (GRCm39) missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37,469,259 (GRCm39) missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37,468,426 (GRCm39) missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37,467,381 (GRCm39) missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37,467,388 (GRCm39) missense possibly damaging 0.95
R5465:Pcdhb6 UTSW 18 37,467,783 (GRCm39) missense probably damaging 0.97
R5522:Pcdhb6 UTSW 18 37,467,402 (GRCm39) missense probably benign
R5556:Pcdhb6 UTSW 18 37,467,442 (GRCm39) missense probably damaging 1.00
R5703:Pcdhb6 UTSW 18 37,467,753 (GRCm39) missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37,467,966 (GRCm39) missense probably benign 0.00
R6256:Pcdhb6 UTSW 18 37,468,978 (GRCm39) missense probably damaging 0.98
R6304:Pcdhb6 UTSW 18 37,468,974 (GRCm39) nonsense probably null
R6528:Pcdhb6 UTSW 18 37,467,556 (GRCm39) missense probably damaging 1.00
R6883:Pcdhb6 UTSW 18 37,468,198 (GRCm39) missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37,469,329 (GRCm39) missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37,468,531 (GRCm39) missense probably benign
R7313:Pcdhb6 UTSW 18 37,468,261 (GRCm39) missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37,468,225 (GRCm39) missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37,468,332 (GRCm39) missense possibly damaging 0.60
R7701:Pcdhb6 UTSW 18 37,467,562 (GRCm39) missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37,469,365 (GRCm39) missense probably benign 0.05
R7905:Pcdhb6 UTSW 18 37,467,607 (GRCm39) missense probably benign 0.00
R7982:Pcdhb6 UTSW 18 37,467,273 (GRCm39) nonsense probably null
R8818:Pcdhb6 UTSW 18 37,468,837 (GRCm39) missense probably benign 0.06
R8917:Pcdhb6 UTSW 18 37,468,431 (GRCm39) missense possibly damaging 0.92
R9397:Pcdhb6 UTSW 18 37,469,353 (GRCm39) missense probably benign 0.00
Z1088:Pcdhb6 UTSW 18 37,468,199 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGTGCCACAGACTCAG -3'
(R):5'- GAGCAACTGGAATGACAGCC -3'

Sequencing Primer
(F):5'- GACTCAGACTCAGGCTCCAATG -3'
(R):5'- CACTTTGGTTACCAGGTAGCCAG -3'
Posted On 2019-10-24