Incidental Mutation 'R7606:Ppp1ca'
ID588338
Institutional Source Beutler Lab
Gene Symbol Ppp1ca
Ensembl Gene ENSMUSG00000040385
Gene Nameprotein phosphatase 1, catalytic subunit, alpha isoform
Synonymsdism2, Ppp1c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7606 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4192158-4195419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4193089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 85 (S85R)
Ref Sequence ENSEMBL: ENSMUSP00000039109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025740] [ENSMUST00000045864] [ENSMUST00000046094]
Predicted Effect probably benign
Transcript: ENSMUST00000025740
SMART Domains Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824

DomainStartEndE-ValueType
Pfam:Rad9 13 265 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045864
SMART Domains Protein: ENSMUSP00000042660
Gene: ENSMUSG00000040247

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
TBC 87 301 7.1e-61 SMART
low complexity region 393 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000046094
AA Change: S85R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039109
Gene: ENSMUSG00000040385
AA Change: S85R

DomainStartEndE-ValueType
PP2Ac 30 300 1.4e-164 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,036,035 probably null Het
Adat1 T C 8: 111,982,604 K196E possibly damaging Het
Aire T C 10: 78,037,933 D314G probably damaging Het
Atp11a C T 8: 12,844,427 T674I probably damaging Het
Atp8b1 T C 18: 64,555,115 D644G probably damaging Het
Bag4 A G 8: 25,769,305 S289P probably damaging Het
Bcat1 G T 6: 145,048,632 H46Q probably benign Het
Btg4 A G 9: 51,118,007 N164S probably damaging Het
Ccz1 G A 5: 144,014,808 A2V probably benign Het
Cd209g T C 8: 4,136,839 L128P probably damaging Het
Col4a2 T A 8: 11,443,571 M1380K probably benign Het
Cpox T C 16: 58,674,449 V283A probably benign Het
Dnah10 A T 5: 124,817,712 D3504V probably benign Het
Eml1 A T 12: 108,537,366 I741F probably benign Het
Fam171a2 A G 11: 102,444,176 V45A possibly damaging Het
Fem1a A G 17: 56,256,946 D13G probably damaging Het
Fkbp14 A G 6: 54,593,018 I9T probably benign Het
Golt1b G A 6: 142,392,342 G13D probably damaging Het
Heatr5b T C 17: 78,763,026 N1653D probably benign Het
Hrg A G 16: 22,951,123 M1V probably null Het
Itgb2 T A 10: 77,556,161 I356N probably damaging Het
Kcnb2 A G 1: 15,312,840 E130G probably damaging Het
Kpna2 A T 11: 106,992,058 F124Y probably damaging Het
Lyst T C 13: 13,637,475 I824T probably damaging Het
Meis2 T C 2: 116,063,320 H38R possibly damaging Het
Mknk1 T G 4: 115,877,994 I353S probably damaging Het
Mrc1 T A 2: 14,238,144 I27N probably damaging Het
Mup4 T C 4: 59,958,568 T111A probably damaging Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Neb T G 2: 52,226,444 E994A Het
Nlrc5 T C 8: 94,477,117 M615T possibly damaging Het
Nup88 T C 11: 70,961,615 E218G possibly damaging Het
Olfr1219 A G 2: 89,075,297 probably benign Het
Olfr1513 A T 14: 52,349,963 F28I probably benign Het
Parp11 A G 6: 127,470,760 D19G probably benign Het
Parp2 A T 14: 50,820,030 T429S probably damaging Het
Pcdhb6 G A 18: 37,335,606 E527K probably damaging Het
Pde8a A G 7: 81,332,967 Y778C probably damaging Het
Pea15a T C 1: 172,200,583 probably null Het
Plcd3 A G 11: 103,076,857 Y420H probably damaging Het
Pth A C 7: 113,386,243 I13S probably benign Het
Rbm27 A G 18: 42,327,513 T842A probably damaging Het
Rcbtb2 T A 14: 73,182,366 probably null Het
Rubcnl C T 14: 75,038,874 L323F probably benign Het
Ryr3 A T 2: 112,645,245 Y4539* probably null Het
Scamp3 T A 3: 89,181,218 F244I probably damaging Het
Sema4d T C 13: 51,723,622 D58G probably benign Het
Skor1 G T 9: 63,145,382 A435E probably damaging Het
Slc35a4 A G 18: 36,682,585 Y156C probably benign Het
Spryd7 T C 14: 61,540,158 T158A possibly damaging Het
Srgap3 A C 6: 112,739,376 I621S probably benign Het
Tbc1d31 A G 15: 57,951,670 E581G probably damaging Het
Tcf4 C T 18: 69,642,983 T318I probably damaging Het
Usf3 C T 16: 44,218,943 T1262M probably damaging Het
Vcam1 T C 3: 116,121,055 D316G possibly damaging Het
Vmn2r72 T A 7: 85,751,154 E229V possibly damaging Het
Zfhx2 T C 14: 55,066,663 E1288G probably benign Het
Other mutations in Ppp1ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ppp1ca APN 19 4193144 missense probably benign 0.25
IGL00834:Ppp1ca APN 19 4194520 missense probably benign 0.20
IGL01017:Ppp1ca APN 19 4193111 missense probably damaging 0.96
IGL02150:Ppp1ca APN 19 4194699 splice site probably benign
IGL02295:Ppp1ca APN 19 4194482 nonsense probably null
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R2680:Ppp1ca UTSW 19 4194595 missense possibly damaging 0.81
R3978:Ppp1ca UTSW 19 4192254 missense probably benign 0.05
R4514:Ppp1ca UTSW 19 4195055 missense probably benign
R5131:Ppp1ca UTSW 19 4194896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCACAGAACCCTTTTGC -3'
(R):5'- TGTAGTTCTGGGCAGACAGC -3'

Sequencing Primer
(F):5'- TGAAAATAGCCCCTACTCGTG -3'
(R):5'- GCAACATTCAAAGCACTTACATTC -3'
Posted On2019-10-24