Mutagenetix > Incidental Mutation

Incidental Mutation 'R7607:Cobll1'

588342

Institutional Source

Beutler Lab

Gene Symbol

Cobll1

Ensembl Gene

ENSMUSG00000034903

Gene Name

Cobl-like 1

Synonyms

D430044D16Rik, Coblr1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.385) question?

Stock #

R7607 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65088339-65239403 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65095857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1119 (N1119S)

Ref Sequence

ENSEMBL: ENSMUSP00000088412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090896
AA Change: N1119S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: N1119S

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	1.3e-38	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	426	438	N/A	INTRINSIC
low complexity region	1023	1034	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102726
AA Change: N1156S

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: N1156S

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	5.6e-39	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1060	1071	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112429
AA Change: N1157S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: N1157S

Domain	Start	End	E-Value	Type
Pfam:Cobl	148	239	5.4e-49	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1061	1072	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112430
AA Change: N1118S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: N1118S

Domain	Start	End	E-Value	Type
low complexity region	146	157	N/A	INTRINSIC
Pfam:Cobl	185	263	1.3e-38	PFAM
low complexity region	331	342	N/A	INTRINSIC
low complexity region	425	437	N/A	INTRINSIC
low complexity region	1022	1033	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112431
AA Change: N1157S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: N1157S

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	5.6e-39	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1061	1072	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010K14Rik	A	T	11: 70,237,557	H30Q	probably damaging	Het
1700012P22Rik	T	A	4: 144,419,762	H107L	probably damaging	Het
A930009A15Rik	G	A	10: 115,581,989		probably null	Het
Abca7	T	C	10: 80,011,833	L1779P	probably damaging	Het
Aff1	G	A	5: 103,849,459	V1140I	possibly damaging	Het
Ano2	C	T	6: 125,712,419	A169V	probably damaging	Het
Atat1	T	C	17: 35,909,107	Y101C	possibly damaging	Het
Atp6v1c1	T	C	15: 38,683,011		probably null	Het
Atp7b	T	G	8: 22,011,506	K912T	probably damaging	Het
Ceacam14	T	C	7: 17,814,321	V112A	possibly damaging	Het
Csmd1	G	T	8: 15,918,331	Q3099K	possibly damaging	Het
Cyp3a25	A	G	5: 145,984,981	V381A	possibly damaging	Het
Dctn1	C	T	6: 83,195,069	R948*	probably null	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Esrp1	A	G	4: 11,384,449	V78A	probably damaging	Het
Evc2	A	G	5: 37,386,856	T650A	possibly damaging	Het
Exoc6b	T	A	6: 84,989,409	K194N	possibly damaging	Het
Fer1l6	G	A	15: 58,662,732	W1809*	probably null	Het
Frmd4a	T	A	2: 4,591,936	L156*	probably null	Het
Gk5	A	T	9: 96,153,210		probably null	Het
Gm3573	A	G	14: 42,189,750	F8L	probably benign	Het
Gm906	T	C	13: 50,250,260	E2G	possibly damaging	Het
Gm9767	G	A	10: 26,078,940	C130Y	unknown	Het
Grip2	T	C	6: 91,788,412	T30A	probably benign	Het
Gskip	C	A	12: 105,698,897	A65E	possibly damaging	Het
Gtf2e2	A	G	8: 33,776,465	R259G	probably benign	Het
Gucy1b2	T	A	14: 62,419,177	I244F	probably damaging	Het
Gxylt2	G	T	6: 100,798,190	V357L	possibly damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igdcc4	C	T	9: 65,133,758	P1024S	possibly damaging	Het
Ino80	A	T	2: 119,382,269		probably null	Het
Knl1	T	C	2: 119,095,133	F1881S	possibly damaging	Het
Mbd6	T	C	10: 127,285,230	E518G	unknown	Het
Mlh1	A	G	9: 111,229,890	S689P	probably damaging	Het
Mmrn2	T	C	14: 34,398,940	I589T	possibly damaging	Het
Mtmr12	C	T	15: 12,257,708	Q291*	probably null	Het
Mup8	T	A	4: 60,222,035	I33F	probably benign	Het
Mylk	C	T	16: 34,894,814	P504L	probably benign	Het
Ntrk3	C	T	7: 78,250,873	A573T	probably benign	Het
Obscn	G	T	11: 58,998,265	S7560R	unknown	Het
Olfr24	A	G	9: 18,754,882	F251S	possibly damaging	Het
Olfr617	A	C	7: 103,584,930	T303P	probably damaging	Het
Pde1c	T	C	6: 56,150,628	T391A	probably damaging	Het
Pla2g4d	T	A	2: 120,288,976	H19L	probably benign	Het
Plce1	C	A	19: 38,524,752	A165E	probably benign	Het
Polr1a	T	C	6: 71,913,021	S75P	probably benign	Het
Psg21	T	C	7: 18,654,783	E128G	probably benign	Het
Radil	A	T	5: 142,494,795	M635K	probably damaging	Het
Radil	A	G	5: 142,506,613	I420T	probably damaging	Het
Rnase11	G	A	14: 51,049,572	T175I	probably damaging	Het
Robo1	C	T	16: 72,563,738	P13S		Het
Slc18a2	C	A	19: 59,284,358	A364D	probably benign	Het
Snph	C	T	2: 151,594,586	D141N	probably damaging	Het
Snrnp70	T	C	7: 45,392,264	K70R	possibly damaging	Het
Snx33	T	C	9: 56,926,713	D24G	probably benign	Het
Spag6	T	A	2: 18,731,962	D165E	possibly damaging	Het
Spata31	T	G	13: 64,921,592	L518R	probably damaging	Het
Sspo	G	A	6: 48,489,727	V4059M	probably damaging	Het
St6galnac2	T	C	11: 116,679,979	Y261C	probably damaging	Het
Stoml1	A	G	9: 58,256,658	R87G	probably damaging	Het
Suv39h2	T	C	2: 3,474,829	T40A	unknown	Het
Terb2	G	T	2: 122,186,475	G26W	probably damaging	Het
Tmem62	T	C	2: 120,996,440	I406T	probably benign	Het
Tnfrsf11a	G	A	1: 105,844,732	V582I	probably benign	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Unc13c	T	C	9: 73,669,535	D1480G	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn1r48	C	A	6: 90,035,980	V288L	probably benign	Het
Vmn2r13	A	G	5: 109,173,640	V397A	probably damaging	Het
Vmn2r98	A	G	17: 19,067,308	N468D	possibly damaging	Het
Zfhx2	G	T	14: 55,066,231	T1432K	possibly damaging	Het
Zswim5	T	A	4: 116,986,742	D992E	possibly damaging	Het

Other mutations in Cobll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00789:Cobll1	APN	2	65126013	missense	probably damaging	1.00
IGL01074:Cobll1	APN	2	65107848	missense	probably damaging	1.00
IGL01093:Cobll1	APN	2	65098237	missense	probably damaging	1.00
IGL02411:Cobll1	APN	2	65097740	missense	probably damaging	1.00
IGL02419:Cobll1	APN	2	65151048	missense	probably damaging	1.00
IGL02550:Cobll1	APN	2	65107863	missense	probably damaging	1.00
IGL02607:Cobll1	APN	2	65151085	missense	probably damaging	0.98
IGL02829:Cobll1	APN	2	65126045	missense	probably damaging	1.00
IGL02802:Cobll1	UTSW	2	65098319	missense	probably damaging	0.99
R0313:Cobll1	UTSW	2	65095744	nonsense	probably null
R0314:Cobll1	UTSW	2	65089521	missense	possibly damaging	0.81
R0322:Cobll1	UTSW	2	65102098	missense	possibly damaging	0.84
R0846:Cobll1	UTSW	2	65102065	splice site	probably null
R1163:Cobll1	UTSW	2	65098279	missense	probably damaging	0.96
R1242:Cobll1	UTSW	2	65151169	critical splice acceptor site	probably null
R1364:Cobll1	UTSW	2	65126310	splice site	probably benign
R1445:Cobll1	UTSW	2	65099136	missense	probably damaging	1.00
R1610:Cobll1	UTSW	2	65133642	missense	probably damaging	1.00
R1836:Cobll1	UTSW	2	65126236	missense	probably damaging	1.00
R2102:Cobll1	UTSW	2	65098210	missense	probably damaging	1.00
R3154:Cobll1	UTSW	2	65107050	missense	probably benign	0.00
R4580:Cobll1	UTSW	2	65151073	missense	probably benign	0.00
R4638:Cobll1	UTSW	2	65099237	missense	probably benign	0.03
R4684:Cobll1	UTSW	2	65099028	missense	possibly damaging	0.90
R4906:Cobll1	UTSW	2	65097693	missense	probably benign	0.01
R4923:Cobll1	UTSW	2	65099258	missense	possibly damaging	0.87
R5100:Cobll1	UTSW	2	65125901	missense	probably benign	0.26
R5269:Cobll1	UTSW	2	65133771	nonsense	probably null
R5419:Cobll1	UTSW	2	65103357	missense	possibly damaging	0.57
R5637:Cobll1	UTSW	2	65125903	missense	possibly damaging	0.90
R5745:Cobll1	UTSW	2	65098457	missense	probably damaging	0.99
R5777:Cobll1	UTSW	2	65103268	missense	probably benign	0.27
R6303:Cobll1	UTSW	2	65098033	missense	possibly damaging	0.68
R6471:Cobll1	UTSW	2	65107884	missense	probably damaging	1.00
R7027:Cobll1	UTSW	2	65089503	missense	probably benign	0.00
R7132:Cobll1	UTSW	2	65133768	missense	probably damaging	1.00
R7197:Cobll1	UTSW	2	65098538	missense	probably benign	0.00
R7365:Cobll1	UTSW	2	65098373	missense	probably damaging	0.99
R7899:Cobll1	UTSW	2	65125931	missense	probably damaging	1.00
R7996:Cobll1	UTSW	2	65150985	missense	possibly damaging	0.93
R8175:Cobll1	UTSW	2	65099231	missense	probably benign
R8212:Cobll1	UTSW	2	65102080	missense	probably benign	0.08
R8549:Cobll1	UTSW	2	65098450	missense	probably damaging	1.00
R8832:Cobll1	UTSW	2	65099258	missense	probably damaging	1.00
R9189:Cobll1	UTSW	2	65150989	missense	probably damaging	1.00
R9253:Cobll1	UTSW	2	65151159	missense	probably benign	0.10
R9273:Cobll1	UTSW	2	65099012	missense	probably damaging	1.00
R9309:Cobll1	UTSW	2	65125927	missense	probably damaging	0.96
R9332:Cobll1	UTSW	2	65103172	missense	probably benign
R9469:Cobll1	UTSW	2	65136430	missense	probably damaging	1.00
X0020:Cobll1	UTSW	2	65103322	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGACAAGGTTGAAAATAAGCCCAC -3'
(R):5'- AGGTAGATCATTGATCTCCCAGC -3'

Sequencing Primer
(F):5'- CACTGTTACCCATCTGATAGGG -3'
(R):5'- CTAGCCTGACAGAACTGAGGC -3'

Posted On

2019-10-24