Incidental Mutation 'R7607:Knl1'
ID 588343
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Name kinetochore scaffold 1
Synonyms Casc5, 2310043D08Rik, 5730505K17Rik
MMRRC Submission 045677-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 118877600-118935982 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118925614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1881 (F1881S)
Ref Sequence ENSEMBL: ENSMUSP00000028802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028802] [ENSMUST00000099542]
AlphaFold Q66JQ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000028802
AA Change: F1881S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: F1881S

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000099542
AA Change: F1881S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: F1881S

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,128,383 (GRCm39) H30Q probably damaging Het
A930009A15Rik G A 10: 115,417,894 (GRCm39) probably null Het
Abca7 T C 10: 79,847,667 (GRCm39) L1779P probably damaging Het
Aff1 G A 5: 103,997,325 (GRCm39) V1140I possibly damaging Het
Ano2 C T 6: 125,689,382 (GRCm39) A169V probably damaging Het
Atat1 T C 17: 36,219,999 (GRCm39) Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,255 (GRCm39) probably null Het
Atp7b T G 8: 22,501,522 (GRCm39) K912T probably damaging Het
Ceacam14 T C 7: 17,548,246 (GRCm39) V112A possibly damaging Het
Cfap107 T A 4: 144,146,332 (GRCm39) H107L probably damaging Het
Cobll1 T C 2: 64,926,201 (GRCm39) N1119S probably benign Het
Csmd1 G T 8: 15,968,331 (GRCm39) Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,921,791 (GRCm39) V381A possibly damaging Het
Dctn1 C T 6: 83,172,051 (GRCm39) R948* probably null Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Esrp1 A G 4: 11,384,449 (GRCm39) V78A probably damaging Het
Evc2 A G 5: 37,544,200 (GRCm39) T650A possibly damaging Het
Exoc6b T A 6: 84,966,391 (GRCm39) K194N possibly damaging Het
Fer1l6 G A 15: 58,534,581 (GRCm39) W1809* probably null Het
Frmd4a T A 2: 4,596,747 (GRCm39) L156* probably null Het
Gk5 A T 9: 96,035,263 (GRCm39) probably null Het
Gm3573 A G 14: 42,011,707 (GRCm39) F8L probably benign Het
Gm9767 G A 10: 25,954,838 (GRCm39) C130Y unknown Het
Grip2 T C 6: 91,765,393 (GRCm39) T30A probably benign Het
Gskip C A 12: 105,665,156 (GRCm39) A65E possibly damaging Het
Gtf2e2 A G 8: 34,266,493 (GRCm39) R259G probably benign Het
Gucy1b2 T A 14: 62,656,626 (GRCm39) I244F probably damaging Het
Gxylt2 G T 6: 100,775,151 (GRCm39) V357L possibly damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igdcc4 C T 9: 65,041,040 (GRCm39) P1024S possibly damaging Het
Ino80 A T 2: 119,212,750 (GRCm39) probably null Het
Mbd6 T C 10: 127,121,099 (GRCm39) E518G unknown Het
Mlh1 A G 9: 111,058,958 (GRCm39) S689P probably damaging Het
Mmrn2 T C 14: 34,120,897 (GRCm39) I589T possibly damaging Het
Mtmr12 C T 15: 12,257,794 (GRCm39) Q291* probably null Het
Mup8 T A 4: 60,222,035 (GRCm39) I33F probably benign Het
Mylk C T 16: 34,715,184 (GRCm39) P504L probably benign Het
Ntrk3 C T 7: 77,900,621 (GRCm39) A573T probably benign Het
Obscn G T 11: 58,889,091 (GRCm39) S7560R unknown Het
Or1m1 A G 9: 18,666,178 (GRCm39) F251S possibly damaging Het
Or52z12 A C 7: 103,234,137 (GRCm39) T303P probably damaging Het
Pde1c T C 6: 56,127,613 (GRCm39) T391A probably damaging Het
Pla2g4d T A 2: 120,119,457 (GRCm39) H19L probably benign Het
Plce1 C A 19: 38,513,196 (GRCm39) A165E probably benign Het
Polr1a T C 6: 71,890,005 (GRCm39) S75P probably benign Het
Psg21 T C 7: 18,388,708 (GRCm39) E128G probably benign Het
Radil A G 5: 142,492,368 (GRCm39) I420T probably damaging Het
Radil A T 5: 142,480,550 (GRCm39) M635K probably damaging Het
Rnase11 G A 14: 51,287,029 (GRCm39) T175I probably damaging Het
Robo1 C T 16: 72,360,626 (GRCm39) P13S Het
Slc18a2 C A 19: 59,272,790 (GRCm39) A364D probably benign Het
Snph C T 2: 151,436,506 (GRCm39) D141N probably damaging Het
Snrnp70 T C 7: 45,041,688 (GRCm39) K70R possibly damaging Het
Snx33 T C 9: 56,833,997 (GRCm39) D24G probably benign Het
Spag6 T A 2: 18,736,773 (GRCm39) D165E possibly damaging Het
Spata31 T G 13: 65,069,406 (GRCm39) L518R probably damaging Het
Spata31e3 T C 13: 50,404,296 (GRCm39) E2G possibly damaging Het
Sspo G A 6: 48,466,661 (GRCm39) V4059M probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stoml1 A G 9: 58,163,941 (GRCm39) R87G probably damaging Het
Suv39h2 T C 2: 3,475,866 (GRCm39) T40A unknown Het
Terb2 G T 2: 122,016,956 (GRCm39) G26W probably damaging Het
Tmem62 T C 2: 120,826,921 (GRCm39) I406T probably benign Het
Tnfrsf11a G A 1: 105,772,458 (GRCm39) V582I probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Unc13c T C 9: 73,576,817 (GRCm39) D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r48 C A 6: 90,012,962 (GRCm39) V288L probably benign Het
Vmn2r13 A G 5: 109,321,506 (GRCm39) V397A probably damaging Het
Vmn2r98 A G 17: 19,287,570 (GRCm39) N468D possibly damaging Het
Zfhx2 G T 14: 55,303,688 (GRCm39) T1432K possibly damaging Het
Zswim5 T A 4: 116,843,939 (GRCm39) D992E possibly damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 118,894,564 (GRCm39) missense probably damaging 0.96
IGL00582:Knl1 APN 2 118,932,980 (GRCm39) missense probably benign 0.19
IGL00666:Knl1 APN 2 118,900,945 (GRCm39) missense probably damaging 0.96
IGL01062:Knl1 APN 2 118,907,461 (GRCm39) missense probably benign 0.33
IGL01395:Knl1 APN 2 118,902,047 (GRCm39) missense probably damaging 0.96
IGL01604:Knl1 APN 2 118,900,482 (GRCm39) missense probably damaging 1.00
IGL01996:Knl1 APN 2 118,934,542 (GRCm39) missense probably damaging 1.00
IGL02086:Knl1 APN 2 118,931,255 (GRCm39) missense probably benign 0.40
IGL02105:Knl1 APN 2 118,902,289 (GRCm39) missense probably benign
IGL02106:Knl1 APN 2 118,902,489 (GRCm39) missense possibly damaging 0.89
IGL02201:Knl1 APN 2 118,899,633 (GRCm39) missense probably benign 0.01
IGL02252:Knl1 APN 2 118,903,021 (GRCm39) missense probably damaging 1.00
IGL02414:Knl1 APN 2 118,900,804 (GRCm39) missense possibly damaging 0.83
IGL02655:Knl1 APN 2 118,901,473 (GRCm39) missense possibly damaging 0.62
IGL02682:Knl1 APN 2 118,908,450 (GRCm39) missense possibly damaging 0.86
IGL02710:Knl1 APN 2 118,901,411 (GRCm39) missense probably damaging 0.99
IGL02877:Knl1 APN 2 118,919,312 (GRCm39) missense probably benign 0.08
IGL03100:Knl1 APN 2 118,931,251 (GRCm39) missense probably damaging 0.99
IGL03210:Knl1 APN 2 118,901,098 (GRCm39) missense probably benign 0.02
IGL03138:Knl1 UTSW 2 118,902,840 (GRCm39) missense probably damaging 0.96
R0023:Knl1 UTSW 2 118,933,030 (GRCm39) missense possibly damaging 0.73
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0078:Knl1 UTSW 2 118,900,373 (GRCm39) missense probably benign 0.16
R0178:Knl1 UTSW 2 118,888,886 (GRCm39) splice site probably benign
R0295:Knl1 UTSW 2 118,919,320 (GRCm39) missense probably damaging 1.00
R0433:Knl1 UTSW 2 118,934,542 (GRCm39) missense probably damaging 0.96
R0453:Knl1 UTSW 2 118,898,869 (GRCm39) missense probably damaging 1.00
R0569:Knl1 UTSW 2 118,927,916 (GRCm39) missense possibly damaging 0.95
R0827:Knl1 UTSW 2 118,919,382 (GRCm39) splice site probably benign
R0920:Knl1 UTSW 2 118,900,309 (GRCm39) missense probably benign 0.00
R1120:Knl1 UTSW 2 118,892,856 (GRCm39) missense probably damaging 0.99
R1155:Knl1 UTSW 2 118,901,635 (GRCm39) missense possibly damaging 0.90
R1204:Knl1 UTSW 2 118,901,670 (GRCm39) missense probably benign 0.00
R1241:Knl1 UTSW 2 118,903,054 (GRCm39) missense probably benign 0.03
R1387:Knl1 UTSW 2 118,901,211 (GRCm39) missense possibly damaging 0.93
R1448:Knl1 UTSW 2 118,898,788 (GRCm39) missense probably damaging 1.00
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1719:Knl1 UTSW 2 118,902,219 (GRCm39) missense probably benign 0.01
R1721:Knl1 UTSW 2 118,906,815 (GRCm39) missense probably damaging 1.00
R2128:Knl1 UTSW 2 118,902,300 (GRCm39) missense possibly damaging 0.79
R2170:Knl1 UTSW 2 118,918,075 (GRCm39) critical splice donor site probably null
R2227:Knl1 UTSW 2 118,902,481 (GRCm39) missense probably damaging 0.97
R2246:Knl1 UTSW 2 118,902,708 (GRCm39) missense probably damaging 1.00
R2275:Knl1 UTSW 2 118,902,762 (GRCm39) missense probably damaging 0.99
R2508:Knl1 UTSW 2 118,888,849 (GRCm39) nonsense probably null
R3115:Knl1 UTSW 2 118,900,872 (GRCm39) missense possibly damaging 0.53
R3122:Knl1 UTSW 2 118,899,425 (GRCm39) missense probably benign 0.32
R3431:Knl1 UTSW 2 118,892,843 (GRCm39) missense probably damaging 1.00
R3755:Knl1 UTSW 2 118,933,060 (GRCm39) missense probably damaging 1.00
R4461:Knl1 UTSW 2 118,890,080 (GRCm39) missense probably benign 0.00
R4600:Knl1 UTSW 2 118,901,025 (GRCm39) missense possibly damaging 0.90
R4713:Knl1 UTSW 2 118,899,618 (GRCm39) nonsense probably null
R4758:Knl1 UTSW 2 118,902,213 (GRCm39) frame shift probably null
R4762:Knl1 UTSW 2 118,902,417 (GRCm39) missense probably benign 0.01
R4869:Knl1 UTSW 2 118,902,832 (GRCm39) missense possibly damaging 0.73
R4870:Knl1 UTSW 2 118,911,994 (GRCm39) missense probably benign 0.22
R4935:Knl1 UTSW 2 118,899,438 (GRCm39) missense possibly damaging 0.50
R5167:Knl1 UTSW 2 118,900,512 (GRCm39) missense probably damaging 1.00
R5184:Knl1 UTSW 2 118,899,657 (GRCm39) missense probably damaging 1.00
R5293:Knl1 UTSW 2 118,900,176 (GRCm39) missense probably damaging 0.99
R5326:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5331:Knl1 UTSW 2 118,900,736 (GRCm39) missense possibly damaging 0.92
R5353:Knl1 UTSW 2 118,901,464 (GRCm39) missense probably benign 0.01
R5493:Knl1 UTSW 2 118,899,211 (GRCm39) missense probably damaging 0.98
R5542:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5632:Knl1 UTSW 2 118,900,833 (GRCm39) missense probably damaging 1.00
R5650:Knl1 UTSW 2 118,912,031 (GRCm39) nonsense probably null
R5854:Knl1 UTSW 2 118,900,884 (GRCm39) missense probably benign 0.02
R5979:Knl1 UTSW 2 118,899,841 (GRCm39) missense possibly damaging 0.83
R6086:Knl1 UTSW 2 118,924,549 (GRCm39) missense probably damaging 1.00
R6283:Knl1 UTSW 2 118,900,767 (GRCm39) missense probably damaging 1.00
R6285:Knl1 UTSW 2 118,902,422 (GRCm39) missense probably damaging 1.00
R6313:Knl1 UTSW 2 118,899,799 (GRCm39) missense probably damaging 1.00
R6419:Knl1 UTSW 2 118,899,484 (GRCm39) missense probably benign 0.02
R6608:Knl1 UTSW 2 118,917,093 (GRCm39) missense probably damaging 0.99
R6881:Knl1 UTSW 2 118,925,665 (GRCm39) missense possibly damaging 0.67
R7161:Knl1 UTSW 2 118,901,266 (GRCm39) missense possibly damaging 0.79
R7206:Knl1 UTSW 2 118,899,780 (GRCm39) missense probably benign 0.35
R7270:Knl1 UTSW 2 118,933,003 (GRCm39) missense possibly damaging 0.53
R7276:Knl1 UTSW 2 118,902,167 (GRCm39) missense probably damaging 0.98
R7358:Knl1 UTSW 2 118,901,040 (GRCm39) missense possibly damaging 0.92
R7402:Knl1 UTSW 2 118,925,707 (GRCm39) nonsense probably null
R7408:Knl1 UTSW 2 118,901,073 (GRCm39) missense possibly damaging 0.54
R7475:Knl1 UTSW 2 118,918,027 (GRCm39) missense probably damaging 1.00
R7516:Knl1 UTSW 2 118,901,179 (GRCm39) missense probably damaging 0.99
R7524:Knl1 UTSW 2 118,896,460 (GRCm39) missense probably damaging 1.00
R7559:Knl1 UTSW 2 118,924,487 (GRCm39) missense possibly damaging 0.84
R7745:Knl1 UTSW 2 118,902,037 (GRCm39) missense probably benign 0.13
R7847:Knl1 UTSW 2 118,901,457 (GRCm39) missense probably benign 0.02
R8423:Knl1 UTSW 2 118,900,513 (GRCm39) missense probably damaging 1.00
R8725:Knl1 UTSW 2 118,899,524 (GRCm39) missense probably benign 0.34
R8727:Knl1 UTSW 2 118,899,524 (GRCm39) missense probably benign 0.34
R8995:Knl1 UTSW 2 118,902,990 (GRCm39) missense probably benign 0.11
R9023:Knl1 UTSW 2 118,900,761 (GRCm39) missense probably benign 0.27
R9100:Knl1 UTSW 2 118,899,469 (GRCm39) missense probably benign 0.02
R9102:Knl1 UTSW 2 118,917,973 (GRCm39) missense probably benign 0.22
R9303:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.83
R9400:Knl1 UTSW 2 118,931,224 (GRCm39) missense probably damaging 0.98
R9426:Knl1 UTSW 2 118,899,979 (GRCm39) missense possibly damaging 0.81
R9583:Knl1 UTSW 2 118,887,782 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,907,425 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,899,994 (GRCm39) missense probably benign 0.02
R9671:Knl1 UTSW 2 118,901,089 (GRCm39) missense probably damaging 1.00
R9766:Knl1 UTSW 2 118,900,381 (GRCm39) missense probably damaging 1.00
R9782:Knl1 UTSW 2 118,899,910 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACAAAGCCAATTAAATTTGAGTTGA -3'
(R):5'- CCTCCAGAGGTCGATAGCA -3'

Sequencing Primer
(F):5'- AGATCTGCCATCAATGCTGG -3'
(R):5'- TCCAGAGGTCGATAGCAATAAATAAG -3'
Posted On 2019-10-24