Incidental Mutation 'R7607:Tmem62'
ID 588345
Institutional Source Beutler Lab
Gene Symbol Tmem62
Ensembl Gene ENSMUSG00000054484
Gene Name transmembrane protein 62
Synonyms B830009D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120977017-121007852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120996440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 406 (I406T)
Ref Sequence ENSEMBL: ENSMUSP00000064310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067582] [ENSMUST00000110686] [ENSMUST00000139428]
AlphaFold Q8BXJ9
Predicted Effect probably benign
Transcript: ENSMUST00000067582
AA Change: I406T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064310
Gene: ENSMUSG00000054484
AA Change: I406T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Metallophos 56 261 7.3e-11 PFAM
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110686
AA Change: I276T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106314
Gene: ENSMUSG00000054484
AA Change: I276T

DomainStartEndE-ValueType
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139428
AA Change: Y301H

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118808
Gene: ENSMUSG00000054484
AA Change: Y301H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
SCOP:d1utea_ 59 274 9e-9 SMART
low complexity region 308 327 N/A INTRINSIC
Meta Mutation Damage Score 0.0753 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Tmem62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tmem62 APN 2 121006964 splice site probably null
IGL01011:Tmem62 APN 2 120979219 missense possibly damaging 0.48
IGL02125:Tmem62 APN 2 120996512 missense probably benign 0.01
IGL02430:Tmem62 APN 2 120986662 missense probably damaging 1.00
R0031:Tmem62 UTSW 2 120999113 missense probably benign 0.00
R0535:Tmem62 UTSW 2 121002596 missense possibly damaging 0.88
R1597:Tmem62 UTSW 2 120984362 missense probably benign 0.01
R1656:Tmem62 UTSW 2 121007002 missense probably benign 0.36
R1682:Tmem62 UTSW 2 121007057 missense probably benign 0.32
R1702:Tmem62 UTSW 2 120979227 missense probably damaging 1.00
R1755:Tmem62 UTSW 2 120984477 critical splice donor site probably null
R1886:Tmem62 UTSW 2 120986670 missense probably damaging 0.99
R1943:Tmem62 UTSW 2 120986626 missense probably benign 0.10
R2151:Tmem62 UTSW 2 120986862 missense probably damaging 1.00
R2419:Tmem62 UTSW 2 121007105 missense probably damaging 0.98
R3034:Tmem62 UTSW 2 120979124 splice site probably benign
R3782:Tmem62 UTSW 2 120977467 missense probably damaging 1.00
R4326:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4328:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4620:Tmem62 UTSW 2 120996364 intron probably benign
R5168:Tmem62 UTSW 2 120993607 missense probably benign 0.16
R5625:Tmem62 UTSW 2 120990393 missense probably damaging 1.00
R6057:Tmem62 UTSW 2 120977462 missense probably damaging 0.98
R6386:Tmem62 UTSW 2 120999114 missense probably benign 0.00
R7038:Tmem62 UTSW 2 120993577 missense possibly damaging 0.87
R7182:Tmem62 UTSW 2 121004743 missense probably benign 0.08
R7569:Tmem62 UTSW 2 121006930 missense probably benign
R7849:Tmem62 UTSW 2 120984372 missense probably benign 0.01
R8353:Tmem62 UTSW 2 120984336 missense probably damaging 0.99
R8531:Tmem62 UTSW 2 121007052 missense probably damaging 0.99
R8944:Tmem62 UTSW 2 120986835 critical splice acceptor site probably null
R9218:Tmem62 UTSW 2 121004743 missense probably benign 0.08
R9448:Tmem62 UTSW 2 120977730 missense probably damaging 1.00
R9597:Tmem62 UTSW 2 120999086 missense probably benign 0.23
X0052:Tmem62 UTSW 2 120993528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCAGCACTGCTTCTAGG -3'
(R):5'- AGGTTTAGATTTCCTGACACATAAC -3'

Sequencing Primer
(F):5'- TCAGATTCAGCCTTCAGGTTTAG -3'
(R):5'- GCATTCACAAAATCCAGTAAG -3'
Posted On 2019-10-24