Mutagenetix > Incidental Mutation

Incidental Mutation 'R7607:Epha7'

588349

Institutional Source

Beutler Lab

Gene Symbol

Epha7

Ensembl Gene

ENSMUSG00000028289

Gene Name

Eph receptor A7

Synonyms

Ehk3, Hek11, Cek11, MDK1, Ebk, Mdk1

MMRRC Submission

045677-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.488) question?

Stock #

R7607 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28813131-28967499 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28871937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 422 (S422L)

Ref Sequence

ENSEMBL: ENSMUSP00000029964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000080934] [ENSMUST00000108191] [ENSMUST00000108194]

AlphaFold

Q61772

Predicted Effect

probably benign
Transcript: ENSMUST00000029964
AA Change: S422L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	557	630	4.4e-25	PFAM
TyrKc	633	890	8.84e-139	SMART
SAM	920	987	1.26e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080934
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000079735
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108191
AA Change: S422L

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	556	626	2.9e-23	PFAM
TyrKc	629	886	8.84e-139	SMART
SAM	916	983	1.26e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108194
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010K14Rik	A	T	11: 70,237,557	H30Q	probably damaging	Het
1700012P22Rik	T	A	4: 144,419,762	H107L	probably damaging	Het
A930009A15Rik	G	A	10: 115,581,989		probably null	Het
Abca7	T	C	10: 80,011,833	L1779P	probably damaging	Het
Aff1	G	A	5: 103,849,459	V1140I	possibly damaging	Het
Ano2	C	T	6: 125,712,419	A169V	probably damaging	Het
Atat1	T	C	17: 35,909,107	Y101C	possibly damaging	Het
Atp6v1c1	T	C	15: 38,683,011		probably null	Het
Atp7b	T	G	8: 22,011,506	K912T	probably damaging	Het
Ceacam14	T	C	7: 17,814,321	V112A	possibly damaging	Het
Cobll1	T	C	2: 65,095,857	N1119S	probably benign	Het
Csmd1	G	T	8: 15,918,331	Q3099K	possibly damaging	Het
Cyp3a25	A	G	5: 145,984,981	V381A	possibly damaging	Het
Dctn1	C	T	6: 83,195,069	R948*	probably null	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Esrp1	A	G	4: 11,384,449	V78A	probably damaging	Het
Evc2	A	G	5: 37,386,856	T650A	possibly damaging	Het
Exoc6b	T	A	6: 84,989,409	K194N	possibly damaging	Het
Fer1l6	G	A	15: 58,662,732	W1809*	probably null	Het
Frmd4a	T	A	2: 4,591,936	L156*	probably null	Het
Gk5	A	T	9: 96,153,210		probably null	Het
Gm3573	A	G	14: 42,189,750	F8L	probably benign	Het
Gm906	T	C	13: 50,250,260	E2G	possibly damaging	Het
Gm9767	G	A	10: 26,078,940	C130Y	unknown	Het
Grip2	T	C	6: 91,788,412	T30A	probably benign	Het
Gskip	C	A	12: 105,698,897	A65E	possibly damaging	Het
Gtf2e2	A	G	8: 33,776,465	R259G	probably benign	Het
Gucy1b2	T	A	14: 62,419,177	I244F	probably damaging	Het
Gxylt2	G	T	6: 100,798,190	V357L	possibly damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igdcc4	C	T	9: 65,133,758	P1024S	possibly damaging	Het
Ino80	A	T	2: 119,382,269		probably null	Het
Knl1	T	C	2: 119,095,133	F1881S	possibly damaging	Het
Mbd6	T	C	10: 127,285,230	E518G	unknown	Het
Mlh1	A	G	9: 111,229,890	S689P	probably damaging	Het
Mmrn2	T	C	14: 34,398,940	I589T	possibly damaging	Het
Mtmr12	C	T	15: 12,257,708	Q291*	probably null	Het
Mup8	T	A	4: 60,222,035	I33F	probably benign	Het
Mylk	C	T	16: 34,894,814	P504L	probably benign	Het
Ntrk3	C	T	7: 78,250,873	A573T	probably benign	Het
Obscn	G	T	11: 58,998,265	S7560R	unknown	Het
Olfr24	A	G	9: 18,754,882	F251S	possibly damaging	Het
Olfr617	A	C	7: 103,584,930	T303P	probably damaging	Het
Pde1c	T	C	6: 56,150,628	T391A	probably damaging	Het
Pla2g4d	T	A	2: 120,288,976	H19L	probably benign	Het
Plce1	C	A	19: 38,524,752	A165E	probably benign	Het
Polr1a	T	C	6: 71,913,021	S75P	probably benign	Het
Psg21	T	C	7: 18,654,783	E128G	probably benign	Het
Radil	A	T	5: 142,494,795	M635K	probably damaging	Het
Radil	A	G	5: 142,506,613	I420T	probably damaging	Het
Rnase11	G	A	14: 51,049,572	T175I	probably damaging	Het
Robo1	C	T	16: 72,563,738	P13S		Het
Slc18a2	C	A	19: 59,284,358	A364D	probably benign	Het
Snph	C	T	2: 151,594,586	D141N	probably damaging	Het
Snrnp70	T	C	7: 45,392,264	K70R	possibly damaging	Het
Snx33	T	C	9: 56,926,713	D24G	probably benign	Het
Spag6	T	A	2: 18,731,962	D165E	possibly damaging	Het
Spata31	T	G	13: 64,921,592	L518R	probably damaging	Het
Sspo	G	A	6: 48,489,727	V4059M	probably damaging	Het
St6galnac2	T	C	11: 116,679,979	Y261C	probably damaging	Het
Stoml1	A	G	9: 58,256,658	R87G	probably damaging	Het
Suv39h2	T	C	2: 3,474,829	T40A	unknown	Het
Terb2	G	T	2: 122,186,475	G26W	probably damaging	Het
Tmem62	T	C	2: 120,996,440	I406T	probably benign	Het
Tnfrsf11a	G	A	1: 105,844,732	V582I	probably benign	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Unc13c	T	C	9: 73,669,535	D1480G	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn1r48	C	A	6: 90,035,980	V288L	probably benign	Het
Vmn2r13	A	G	5: 109,173,640	V397A	probably damaging	Het
Vmn2r98	A	G	17: 19,067,308	N468D	possibly damaging	Het
Zfhx2	G	T	14: 55,066,231	T1432K	possibly damaging	Het
Zswim5	T	A	4: 116,986,742	D992E	possibly damaging	Het

Other mutations in Epha7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Epha7	APN	4	28961285	intron	probably benign
IGL00849:Epha7	APN	4	28870662	missense	possibly damaging	0.63
IGL00898:Epha7	APN	4	28938693	missense	probably damaging	1.00
IGL02036:Epha7	APN	4	28950509	missense	probably damaging	1.00
IGL02227:Epha7	APN	4	28821587	missense	possibly damaging	0.85
IGL02237:Epha7	APN	4	28949325	splice site	probably null
IGL02376:Epha7	APN	4	28951287	missense	probably damaging	1.00
IGL02424:Epha7	APN	4	28948790	intron	probably benign
IGL02519:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02522:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02524:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02602:Epha7	APN	4	28871877	missense	possibly damaging	0.88
Pump	UTSW	4	28871937	missense	probably benign	0.07
PIT4514001:Epha7	UTSW	4	28961355	nonsense	probably null
R0001:Epha7	UTSW	4	28961279	intron	probably benign
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0310:Epha7	UTSW	4	28961301	missense	probably benign	0.33
R0373:Epha7	UTSW	4	28935700	splice site	probably null
R0496:Epha7	UTSW	4	28821292	missense	probably damaging	1.00
R0554:Epha7	UTSW	4	28951401	missense	probably damaging	1.00
R0632:Epha7	UTSW	4	28821104	missense	probably damaging	1.00
R1677:Epha7	UTSW	4	28947571	nonsense	probably null
R1883:Epha7	UTSW	4	28950362	missense	possibly damaging	0.58
R1919:Epha7	UTSW	4	28963969	missense	possibly damaging	0.48
R1952:Epha7	UTSW	4	28950474	missense	probably damaging	0.97
R1999:Epha7	UTSW	4	28938686	nonsense	probably null
R2187:Epha7	UTSW	4	28942648	missense	possibly damaging	0.63
R2308:Epha7	UTSW	4	28821503	missense	possibly damaging	0.91
R2417:Epha7	UTSW	4	28947579	missense	probably damaging	1.00
R3911:Epha7	UTSW	4	28938680	missense	probably benign	0.01
R4350:Epha7	UTSW	4	28950393	missense	probably damaging	0.98
R4688:Epha7	UTSW	4	28821367	missense	probably damaging	1.00
R4702:Epha7	UTSW	4	28961425	missense	probably damaging	1.00
R4957:Epha7	UTSW	4	28871892	missense	probably damaging	0.99
R5364:Epha7	UTSW	4	28950557	missense	probably damaging	1.00
R5661:Epha7	UTSW	4	28946217	splice site	probably null
R5820:Epha7	UTSW	4	28949365	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6592:Epha7	UTSW	4	28813482	critical splice donor site	probably null
R6783:Epha7	UTSW	4	28950528	missense	possibly damaging	0.94
R6991:Epha7	UTSW	4	28821489	missense	probably damaging	1.00
R7152:Epha7	UTSW	4	28935826	missense	possibly damaging	0.94
R7232:Epha7	UTSW	4	28951279	missense	probably damaging	1.00
R7261:Epha7	UTSW	4	28813418	missense	probably benign	0.04
R7365:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7367:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7368:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7413:Epha7	UTSW	4	28871838	missense	probably benign	0.00
R7603:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7604:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7605:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7608:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7609:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7610:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R8073:Epha7	UTSW	4	28821022	missense	probably damaging	1.00
R8263:Epha7	UTSW	4	28821149	missense	probably damaging	1.00
R8334:Epha7	UTSW	4	28938777	missense	probably benign	0.26
R8866:Epha7	UTSW	4	28821614	missense	probably benign	0.04
R8906:Epha7	UTSW	4	28821615	missense	probably damaging	0.98
R8914:Epha7	UTSW	4	28963892	missense	probably damaging	1.00
R9335:Epha7	UTSW	4	28966529	missense	probably benign	0.15
R9355:Epha7	UTSW	4	28935806	missense	probably damaging	1.00
R9576:Epha7	UTSW	4	28870659	missense	probably damaging	1.00
R9796:Epha7	UTSW	4	28817457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGTGTAAGCGGTGCAG -3'
(R):5'- TTTCCCCACCAGAACTATGGG -3'

Sequencing Primer
(F):5'- GCGGTGCAGTTGGGAAC -3'
(R):5'- CCAGAACTATGGGGATATTAAATGAC -3'

Posted On

2019-10-24