Incidental Mutation 'R7607:Hivep3'
ID588352
Institutional Source Beutler Lab
Gene Symbol Hivep3
Ensembl Gene ENSMUSG00000028634
Gene Namehuman immunodeficiency virus type I enhancer binding protein 3
SynonymsE030045D18Rik, Schnurri-3, Shn3, 2900056N03Rik, Krc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7607 (G1)
Quality Score217.468
Status Validated
Chromosome4
Chromosomal Location119733784-120138045 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 120097911 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106307] [ENSMUST00000166542] [ENSMUST00000226560]
Predicted Effect probably null
Transcript: ENSMUST00000106307
SMART Domains Protein: ENSMUSP00000101914
Gene: ENSMUSG00000028634

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166542
SMART Domains Protein: ENSMUSP00000130249
Gene: ENSMUSG00000028634

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226560
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in diminished IL-2 production by stimulated CD4 cells. Mice homozygous for a knock-out allele exhibit increased bone volume. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Hivep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Hivep3 APN 4 120098374 missense probably damaging 1.00
IGL01017:Hivep3 APN 4 120099246 missense probably damaging 0.98
IGL01837:Hivep3 APN 4 120094562 missense possibly damaging 0.72
IGL01878:Hivep3 APN 4 120095227 missense possibly damaging 0.84
IGL02134:Hivep3 APN 4 120133574 splice site probably benign
IGL02183:Hivep3 APN 4 120132024 missense probably benign 0.04
IGL02350:Hivep3 APN 4 120123025 missense probably damaging 1.00
IGL02451:Hivep3 APN 4 120133965 missense probably damaging 1.00
IGL02567:Hivep3 APN 4 120133956 missense probably damaging 0.99
IGL02617:Hivep3 APN 4 120095444 missense probably benign 0.04
IGL02725:Hivep3 APN 4 120095822 missense possibly damaging 0.48
IGL02828:Hivep3 APN 4 120097732 nonsense probably null
IGL02954:Hivep3 APN 4 120133641 missense probably damaging 1.00
IGL02966:Hivep3 APN 4 120132186 missense probably benign 0.04
Deceit UTSW 4 120097911 frame shift probably null
Stealth UTSW 4 120122876 nonsense probably null
PIT4260001:Hivep3 UTSW 4 120099182 missense probably damaging 1.00
R0321:Hivep3 UTSW 4 120095591 missense possibly damaging 0.84
R0336:Hivep3 UTSW 4 120103847 missense probably damaging 1.00
R0558:Hivep3 UTSW 4 120096566 missense probably damaging 0.98
R0562:Hivep3 UTSW 4 120096554 missense probably benign 0.00
R0637:Hivep3 UTSW 4 120132541 nonsense probably null
R0645:Hivep3 UTSW 4 120097334 missense possibly damaging 0.95
R1186:Hivep3 UTSW 4 119814723 start gained probably benign
R1254:Hivep3 UTSW 4 120099293 missense probably damaging 1.00
R1428:Hivep3 UTSW 4 120096575 missense possibly damaging 0.92
R1623:Hivep3 UTSW 4 120095704 missense possibly damaging 0.84
R1739:Hivep3 UTSW 4 120095174 missense probably benign 0.03
R1766:Hivep3 UTSW 4 120096671 missense probably benign
R1769:Hivep3 UTSW 4 120097571 missense possibly damaging 0.68
R1773:Hivep3 UTSW 4 120098837 missense probably damaging 1.00
R1968:Hivep3 UTSW 4 120096238 missense possibly damaging 0.83
R2220:Hivep3 UTSW 4 119734038 missense possibly damaging 0.92
R2428:Hivep3 UTSW 4 120098508 nonsense probably null
R3789:Hivep3 UTSW 4 120098416 missense probably damaging 1.00
R3917:Hivep3 UTSW 4 120099427 missense probably benign 0.27
R4366:Hivep3 UTSW 4 120096089 missense possibly damaging 0.84
R4436:Hivep3 UTSW 4 120095923 missense probably benign 0.11
R4504:Hivep3 UTSW 4 119733793 unclassified probably benign
R4705:Hivep3 UTSW 4 119872050 intron probably benign
R4713:Hivep3 UTSW 4 120131803 missense probably damaging 1.00
R4756:Hivep3 UTSW 4 120097823 missense probably damaging 0.98
R4887:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R4888:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R5008:Hivep3 UTSW 4 120098917 missense probably benign 0.22
R5204:Hivep3 UTSW 4 120103856 critical splice donor site probably null
R5594:Hivep3 UTSW 4 120123048 critical splice donor site probably null
R5697:Hivep3 UTSW 4 120096955 missense possibly damaging 0.68
R5715:Hivep3 UTSW 4 120096373 missense probably benign
R5740:Hivep3 UTSW 4 120096023 missense possibly damaging 0.83
R5760:Hivep3 UTSW 4 120095011 missense possibly damaging 0.83
R5923:Hivep3 UTSW 4 120096293 missense possibly damaging 0.92
R5927:Hivep3 UTSW 4 120097108 missense possibly damaging 0.68
R6042:Hivep3 UTSW 4 120097864 missense possibly damaging 0.85
R6074:Hivep3 UTSW 4 120097694 missense possibly damaging 0.68
R6150:Hivep3 UTSW 4 119734077 nonsense probably null
R6211:Hivep3 UTSW 4 120098405 missense probably damaging 1.00
R6251:Hivep3 UTSW 4 120094940 missense probably damaging 0.98
R6451:Hivep3 UTSW 4 120098908 missense probably benign 0.22
R6531:Hivep3 UTSW 4 120122876 nonsense probably null
R6651:Hivep3 UTSW 4 120122949 missense probably damaging 1.00
R6701:Hivep3 UTSW 4 120094540 missense probably damaging 0.97
R6721:Hivep3 UTSW 4 120095099 missense possibly damaging 0.82
R6796:Hivep3 UTSW 4 120096361 missense possibly damaging 0.68
R6864:Hivep3 UTSW 4 120094888 missense possibly damaging 0.48
R6902:Hivep3 UTSW 4 120095995 missense possibly damaging 0.48
R7111:Hivep3 UTSW 4 120095234 missense possibly damaging 0.68
R7113:Hivep3 UTSW 4 120098369 missense probably damaging 1.00
R7140:Hivep3 UTSW 4 120097121 missense probably damaging 0.99
R7189:Hivep3 UTSW 4 120132219 missense probably damaging 0.99
R7218:Hivep3 UTSW 4 120095452 missense possibly damaging 0.92
R7366:Hivep3 UTSW 4 120097911 frame shift probably null
R7368:Hivep3 UTSW 4 120097911 frame shift probably null
R7491:Hivep3 UTSW 4 120098830 missense probably benign 0.09
R7496:Hivep3 UTSW 4 120132402 missense probably benign 0.00
R7514:Hivep3 UTSW 4 120096855 missense possibly damaging 0.48
R7604:Hivep3 UTSW 4 120097911 frame shift probably null
R7605:Hivep3 UTSW 4 120097911 frame shift probably null
R7610:Hivep3 UTSW 4 120097911 frame shift probably null
R7611:Hivep3 UTSW 4 120097911 frame shift probably null
R7613:Hivep3 UTSW 4 120097911 frame shift probably null
R7626:Hivep3 UTSW 4 120097911 frame shift probably null
R7707:Hivep3 UTSW 4 119733959 missense
R7736:Hivep3 UTSW 4 120095543 missense possibly damaging 0.92
RF019:Hivep3 UTSW 4 120098270 missense probably benign 0.12
X0062:Hivep3 UTSW 4 120098698 missense probably damaging 1.00
X0067:Hivep3 UTSW 4 120131787 missense probably damaging 0.96
Z1176:Hivep3 UTSW 4 120133782 missense probably damaging 1.00
Z1177:Hivep3 UTSW 4 120095946 missense possibly damaging 0.68
Z1177:Hivep3 UTSW 4 120131778 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGATCTCTGTGGGCACTAC -3'
(R):5'- CTGCAGTGCAAACTGGGATTG -3'

Sequencing Primer
(F):5'- ATCTCTGTGGGCACTACGCAAG -3'
(R):5'- TTGCAGAGGGAGGAAATATCC -3'
Posted On2019-10-24