Incidental Mutation 'R7607:Radil'
ID 588359
Institutional Source Beutler Lab
Gene Symbol Radil
Ensembl Gene ENSMUSG00000029576
Gene Name Ras association and DIL domains
Synonyms D930005D10Rik
MMRRC Submission 045677-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 142470594-142536853 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 142492368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 420 (I420T)
Ref Sequence ENSEMBL: ENSMUSP00000064539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063635] [ENSMUST00000085758] [ENSMUST00000110784] [ENSMUST00000110785] [ENSMUST00000139278]
AlphaFold Q69Z89
Predicted Effect probably damaging
Transcript: ENSMUST00000063635
AA Change: I420T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064539
Gene: ENSMUSG00000029576
AA Change: I420T

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 950 964 N/A INTRINSIC
PDZ 979 1056 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085758
AA Change: I449T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082910
Gene: ENSMUSG00000029576
AA Change: I449T

DomainStartEndE-ValueType
RA 90 193 1.68e-15 SMART
Blast:FHA 294 361 2e-25 BLAST
low complexity region 373 383 N/A INTRINSIC
low complexity region 579 589 N/A INTRINSIC
DIL 663 772 6.19e-34 SMART
low complexity region 979 993 N/A INTRINSIC
PDZ 1008 1085 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110784
AA Change: I180T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106411
Gene: ENSMUSG00000029576
AA Change: I180T

DomainStartEndE-ValueType
Blast:FHA 25 92 3e-25 BLAST
low complexity region 104 114 N/A INTRINSIC
low complexity region 310 320 N/A INTRINSIC
DIL 394 503 6.19e-34 SMART
low complexity region 710 724 N/A INTRINSIC
PDZ 739 816 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110785
AA Change: I420T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106412
Gene: ENSMUSG00000029576
AA Change: I420T

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 973 987 N/A INTRINSIC
PDZ 1002 1079 3.86e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139278
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,128,383 (GRCm39) H30Q probably damaging Het
A930009A15Rik G A 10: 115,417,894 (GRCm39) probably null Het
Abca7 T C 10: 79,847,667 (GRCm39) L1779P probably damaging Het
Aff1 G A 5: 103,997,325 (GRCm39) V1140I possibly damaging Het
Ano2 C T 6: 125,689,382 (GRCm39) A169V probably damaging Het
Atat1 T C 17: 36,219,999 (GRCm39) Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,255 (GRCm39) probably null Het
Atp7b T G 8: 22,501,522 (GRCm39) K912T probably damaging Het
Ceacam14 T C 7: 17,548,246 (GRCm39) V112A possibly damaging Het
Cfap107 T A 4: 144,146,332 (GRCm39) H107L probably damaging Het
Cobll1 T C 2: 64,926,201 (GRCm39) N1119S probably benign Het
Csmd1 G T 8: 15,968,331 (GRCm39) Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,921,791 (GRCm39) V381A possibly damaging Het
Dctn1 C T 6: 83,172,051 (GRCm39) R948* probably null Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Esrp1 A G 4: 11,384,449 (GRCm39) V78A probably damaging Het
Evc2 A G 5: 37,544,200 (GRCm39) T650A possibly damaging Het
Exoc6b T A 6: 84,966,391 (GRCm39) K194N possibly damaging Het
Fer1l6 G A 15: 58,534,581 (GRCm39) W1809* probably null Het
Frmd4a T A 2: 4,596,747 (GRCm39) L156* probably null Het
Gk5 A T 9: 96,035,263 (GRCm39) probably null Het
Gm3573 A G 14: 42,011,707 (GRCm39) F8L probably benign Het
Gm9767 G A 10: 25,954,838 (GRCm39) C130Y unknown Het
Grip2 T C 6: 91,765,393 (GRCm39) T30A probably benign Het
Gskip C A 12: 105,665,156 (GRCm39) A65E possibly damaging Het
Gtf2e2 A G 8: 34,266,493 (GRCm39) R259G probably benign Het
Gucy1b2 T A 14: 62,656,626 (GRCm39) I244F probably damaging Het
Gxylt2 G T 6: 100,775,151 (GRCm39) V357L possibly damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igdcc4 C T 9: 65,041,040 (GRCm39) P1024S possibly damaging Het
Ino80 A T 2: 119,212,750 (GRCm39) probably null Het
Knl1 T C 2: 118,925,614 (GRCm39) F1881S possibly damaging Het
Mbd6 T C 10: 127,121,099 (GRCm39) E518G unknown Het
Mlh1 A G 9: 111,058,958 (GRCm39) S689P probably damaging Het
Mmrn2 T C 14: 34,120,897 (GRCm39) I589T possibly damaging Het
Mtmr12 C T 15: 12,257,794 (GRCm39) Q291* probably null Het
Mup8 T A 4: 60,222,035 (GRCm39) I33F probably benign Het
Mylk C T 16: 34,715,184 (GRCm39) P504L probably benign Het
Ntrk3 C T 7: 77,900,621 (GRCm39) A573T probably benign Het
Obscn G T 11: 58,889,091 (GRCm39) S7560R unknown Het
Or1m1 A G 9: 18,666,178 (GRCm39) F251S possibly damaging Het
Or52z12 A C 7: 103,234,137 (GRCm39) T303P probably damaging Het
Pde1c T C 6: 56,127,613 (GRCm39) T391A probably damaging Het
Pla2g4d T A 2: 120,119,457 (GRCm39) H19L probably benign Het
Plce1 C A 19: 38,513,196 (GRCm39) A165E probably benign Het
Polr1a T C 6: 71,890,005 (GRCm39) S75P probably benign Het
Psg21 T C 7: 18,388,708 (GRCm39) E128G probably benign Het
Rnase11 G A 14: 51,287,029 (GRCm39) T175I probably damaging Het
Robo1 C T 16: 72,360,626 (GRCm39) P13S Het
Slc18a2 C A 19: 59,272,790 (GRCm39) A364D probably benign Het
Snph C T 2: 151,436,506 (GRCm39) D141N probably damaging Het
Snrnp70 T C 7: 45,041,688 (GRCm39) K70R possibly damaging Het
Snx33 T C 9: 56,833,997 (GRCm39) D24G probably benign Het
Spag6 T A 2: 18,736,773 (GRCm39) D165E possibly damaging Het
Spata31 T G 13: 65,069,406 (GRCm39) L518R probably damaging Het
Spata31e3 T C 13: 50,404,296 (GRCm39) E2G possibly damaging Het
Sspo G A 6: 48,466,661 (GRCm39) V4059M probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stoml1 A G 9: 58,163,941 (GRCm39) R87G probably damaging Het
Suv39h2 T C 2: 3,475,866 (GRCm39) T40A unknown Het
Terb2 G T 2: 122,016,956 (GRCm39) G26W probably damaging Het
Tmem62 T C 2: 120,826,921 (GRCm39) I406T probably benign Het
Tnfrsf11a G A 1: 105,772,458 (GRCm39) V582I probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Unc13c T C 9: 73,576,817 (GRCm39) D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r48 C A 6: 90,012,962 (GRCm39) V288L probably benign Het
Vmn2r13 A G 5: 109,321,506 (GRCm39) V397A probably damaging Het
Vmn2r98 A G 17: 19,287,570 (GRCm39) N468D possibly damaging Het
Zfhx2 G T 14: 55,303,688 (GRCm39) T1432K possibly damaging Het
Zswim5 T A 4: 116,843,939 (GRCm39) D992E possibly damaging Het
Other mutations in Radil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Radil APN 5 142,483,677 (GRCm39) missense probably damaging 0.99
IGL01359:Radil APN 5 142,529,468 (GRCm39) missense probably damaging 0.98
IGL01714:Radil APN 5 142,529,152 (GRCm39) unclassified probably benign
IGL02086:Radil APN 5 142,529,576 (GRCm39) missense probably benign 0.28
IGL02250:Radil APN 5 142,529,529 (GRCm39) missense probably damaging 1.00
IGL02296:Radil APN 5 142,492,218 (GRCm39) missense probably benign 0.10
IGL02890:Radil APN 5 142,529,463 (GRCm39) missense probably damaging 1.00
IGL02978:Radil APN 5 142,480,674 (GRCm39) missense probably benign 0.00
IGL03131:Radil APN 5 142,481,097 (GRCm39) missense probably damaging 1.00
R0362:Radil UTSW 5 142,529,582 (GRCm39) missense probably benign 0.00
R0389:Radil UTSW 5 142,529,226 (GRCm39) missense probably damaging 0.98
R0426:Radil UTSW 5 142,483,628 (GRCm39) missense probably damaging 1.00
R1753:Radil UTSW 5 142,481,091 (GRCm39) missense probably damaging 1.00
R2168:Radil UTSW 5 142,492,718 (GRCm39) missense probably benign 0.00
R3055:Radil UTSW 5 142,481,161 (GRCm39) missense possibly damaging 0.77
R3177:Radil UTSW 5 142,492,611 (GRCm39) missense probably damaging 1.00
R3277:Radil UTSW 5 142,492,611 (GRCm39) missense probably damaging 1.00
R3851:Radil UTSW 5 142,492,752 (GRCm39) missense probably damaging 1.00
R4043:Radil UTSW 5 142,479,988 (GRCm39) missense probably benign 0.31
R4245:Radil UTSW 5 142,529,546 (GRCm39) missense probably damaging 1.00
R4367:Radil UTSW 5 142,480,560 (GRCm39) missense probably benign 0.06
R4697:Radil UTSW 5 142,472,556 (GRCm39) missense probably benign
R4798:Radil UTSW 5 142,470,918 (GRCm39) missense probably benign 0.39
R4948:Radil UTSW 5 142,470,994 (GRCm39) missense probably benign 0.02
R5407:Radil UTSW 5 142,493,970 (GRCm39) missense probably damaging 1.00
R5784:Radil UTSW 5 142,473,268 (GRCm39) missense possibly damaging 0.88
R5918:Radil UTSW 5 142,473,357 (GRCm39) missense probably benign 0.43
R5943:Radil UTSW 5 142,471,213 (GRCm39) missense probably damaging 1.00
R6112:Radil UTSW 5 142,529,399 (GRCm39) missense probably damaging 1.00
R6147:Radil UTSW 5 142,483,695 (GRCm39) missense probably benign 0.01
R6174:Radil UTSW 5 142,472,870 (GRCm39) missense probably benign
R6241:Radil UTSW 5 142,480,697 (GRCm39) missense probably damaging 1.00
R6874:Radil UTSW 5 142,492,557 (GRCm39) missense probably damaging 1.00
R6881:Radil UTSW 5 142,472,672 (GRCm39) missense probably benign 0.00
R7056:Radil UTSW 5 142,480,109 (GRCm39) nonsense probably null
R7134:Radil UTSW 5 142,471,304 (GRCm39) missense probably damaging 1.00
R7167:Radil UTSW 5 142,471,260 (GRCm39) splice site probably null
R7374:Radil UTSW 5 142,471,235 (GRCm39) missense probably damaging 1.00
R7482:Radil UTSW 5 142,472,518 (GRCm39) missense probably benign
R7607:Radil UTSW 5 142,480,550 (GRCm39) missense probably damaging 0.98
R7777:Radil UTSW 5 142,529,303 (GRCm39) missense probably damaging 1.00
R7779:Radil UTSW 5 142,473,320 (GRCm39) missense probably benign 0.03
R8047:Radil UTSW 5 142,480,695 (GRCm39) missense probably damaging 1.00
R8123:Radil UTSW 5 142,473,375 (GRCm39) missense probably damaging 0.99
R8418:Radil UTSW 5 142,480,676 (GRCm39) missense probably benign 0.23
R8525:Radil UTSW 5 142,474,256 (GRCm39) missense probably damaging 1.00
R8708:Radil UTSW 5 142,471,204 (GRCm39) missense probably damaging 1.00
R8827:Radil UTSW 5 142,493,859 (GRCm39) missense probably damaging 1.00
R9181:Radil UTSW 5 142,480,722 (GRCm39) missense probably damaging 1.00
R9315:Radil UTSW 5 142,474,254 (GRCm39) missense probably damaging 0.98
R9462:Radil UTSW 5 142,471,220 (GRCm39) missense probably damaging 1.00
R9545:Radil UTSW 5 142,492,392 (GRCm39) missense probably benign
R9694:Radil UTSW 5 142,473,378 (GRCm39) missense probably damaging 1.00
X0058:Radil UTSW 5 142,473,269 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGTAAAGACACCAGCCATC -3'
(R):5'- GGGTCTCTATTACCTGCTGCTG -3'

Sequencing Primer
(F):5'- TGGTAAAGACACCAGCCATCATACTC -3'
(R):5'- ACCTGCTGCTGTTCAAGGAC -3'
Posted On 2019-10-24