Incidental Mutation 'R7607:Radil'
ID 588359
Institutional Source Beutler Lab
Gene Symbol Radil
Ensembl Gene ENSMUSG00000029576
Gene Name Ras association and DIL domains
Synonyms D930005D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 142484839-142551098 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 142506613 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 420 (I420T)
Ref Sequence ENSEMBL: ENSMUSP00000064539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063635] [ENSMUST00000085758] [ENSMUST00000110784] [ENSMUST00000110785] [ENSMUST00000139278]
AlphaFold Q69Z89
Predicted Effect probably damaging
Transcript: ENSMUST00000063635
AA Change: I420T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064539
Gene: ENSMUSG00000029576
AA Change: I420T

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 950 964 N/A INTRINSIC
PDZ 979 1056 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085758
AA Change: I449T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082910
Gene: ENSMUSG00000029576
AA Change: I449T

DomainStartEndE-ValueType
RA 90 193 1.68e-15 SMART
Blast:FHA 294 361 2e-25 BLAST
low complexity region 373 383 N/A INTRINSIC
low complexity region 579 589 N/A INTRINSIC
DIL 663 772 6.19e-34 SMART
low complexity region 979 993 N/A INTRINSIC
PDZ 1008 1085 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110784
AA Change: I180T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106411
Gene: ENSMUSG00000029576
AA Change: I180T

DomainStartEndE-ValueType
Blast:FHA 25 92 3e-25 BLAST
low complexity region 104 114 N/A INTRINSIC
low complexity region 310 320 N/A INTRINSIC
DIL 394 503 6.19e-34 SMART
low complexity region 710 724 N/A INTRINSIC
PDZ 739 816 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110785
AA Change: I420T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106412
Gene: ENSMUSG00000029576
AA Change: I420T

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 973 987 N/A INTRINSIC
PDZ 1002 1079 3.86e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139278
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Radil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Radil APN 5 142497922 missense probably damaging 0.99
IGL01359:Radil APN 5 142543713 missense probably damaging 0.98
IGL01714:Radil APN 5 142543397 unclassified probably benign
IGL02086:Radil APN 5 142543821 missense probably benign 0.28
IGL02250:Radil APN 5 142543774 missense probably damaging 1.00
IGL02296:Radil APN 5 142506463 missense probably benign 0.10
IGL02890:Radil APN 5 142543708 missense probably damaging 1.00
IGL02978:Radil APN 5 142494919 missense probably benign 0.00
IGL03131:Radil APN 5 142495342 missense probably damaging 1.00
R0362:Radil UTSW 5 142543827 missense probably benign 0.00
R0389:Radil UTSW 5 142543471 missense probably damaging 0.98
R0426:Radil UTSW 5 142497873 missense probably damaging 1.00
R1753:Radil UTSW 5 142495336 missense probably damaging 1.00
R2168:Radil UTSW 5 142506963 missense probably benign 0.00
R3055:Radil UTSW 5 142495406 missense possibly damaging 0.77
R3177:Radil UTSW 5 142506856 missense probably damaging 1.00
R3277:Radil UTSW 5 142506856 missense probably damaging 1.00
R3851:Radil UTSW 5 142506997 missense probably damaging 1.00
R4043:Radil UTSW 5 142494233 missense probably benign 0.31
R4245:Radil UTSW 5 142543791 missense probably damaging 1.00
R4367:Radil UTSW 5 142494805 missense probably benign 0.06
R4697:Radil UTSW 5 142486801 missense probably benign
R4798:Radil UTSW 5 142485163 missense probably benign 0.39
R4948:Radil UTSW 5 142485239 missense probably benign 0.02
R5407:Radil UTSW 5 142508215 missense probably damaging 1.00
R5784:Radil UTSW 5 142487513 missense possibly damaging 0.88
R5918:Radil UTSW 5 142487602 missense probably benign 0.43
R5943:Radil UTSW 5 142485458 missense probably damaging 1.00
R6112:Radil UTSW 5 142543644 missense probably damaging 1.00
R6147:Radil UTSW 5 142497940 missense probably benign 0.01
R6174:Radil UTSW 5 142487115 missense probably benign
R6241:Radil UTSW 5 142494942 missense probably damaging 1.00
R6874:Radil UTSW 5 142506802 missense probably damaging 1.00
R6881:Radil UTSW 5 142486917 missense probably benign 0.00
R7056:Radil UTSW 5 142494354 nonsense probably null
R7134:Radil UTSW 5 142485549 missense probably damaging 1.00
R7167:Radil UTSW 5 142485505 splice site probably null
R7374:Radil UTSW 5 142485480 missense probably damaging 1.00
R7482:Radil UTSW 5 142486763 missense probably benign
R7607:Radil UTSW 5 142494795 missense probably damaging 0.98
R7777:Radil UTSW 5 142543548 missense probably damaging 1.00
R7779:Radil UTSW 5 142487565 missense probably benign 0.03
R8047:Radil UTSW 5 142494940 missense probably damaging 1.00
R8123:Radil UTSW 5 142487620 missense probably damaging 0.99
R8418:Radil UTSW 5 142494921 missense probably benign 0.23
R8525:Radil UTSW 5 142488501 missense probably damaging 1.00
R8708:Radil UTSW 5 142485449 missense probably damaging 1.00
R8827:Radil UTSW 5 142508104 missense probably damaging 1.00
R9181:Radil UTSW 5 142494967 missense probably damaging 1.00
R9315:Radil UTSW 5 142488499 missense probably damaging 0.98
R9462:Radil UTSW 5 142485465 missense probably damaging 1.00
R9545:Radil UTSW 5 142506637 missense probably benign
R9694:Radil UTSW 5 142487623 missense probably damaging 1.00
X0058:Radil UTSW 5 142487514 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGTAAAGACACCAGCCATC -3'
(R):5'- GGGTCTCTATTACCTGCTGCTG -3'

Sequencing Primer
(F):5'- TGGTAAAGACACCAGCCATCATACTC -3'
(R):5'- ACCTGCTGCTGTTCAAGGAC -3'
Posted On 2019-10-24