Incidental Mutation 'R7607:Polr1a'
ID588363
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7607 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71913021 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 75 (S75P)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000082094] [ENSMUST00000206556] [ENSMUST00000206879]
Predicted Effect probably benign
Transcript: ENSMUST00000055296
AA Change: S75P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: S75P

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082094
SMART Domains Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 216 227 N/A INTRINSIC
Pfam:PPR_2 253 300 1.4e-10 PFAM
Pfam:PPR_3 331 366 2.1e-4 PFAM
low complexity region 671 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206284
Predicted Effect probably benign
Transcript: ENSMUST00000206556
AA Change: S75P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206879
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 intron probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R7918:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGTCTGGCTTATAACCTGCC -3'
(R):5'- AGGGTGTACAGTTTCTAGGTCC -3'

Sequencing Primer
(F):5'- AATAACTTGAGCTTTCCCTGGG -3'
(R):5'- GGTGTACAGTTTCTAGGTCCATAAAG -3'
Posted On2019-10-24