Incidental Mutation 'R7607:Dctn1'
ID588364
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Namedynactin 1
Synonymsp150, Glued, p150
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7607 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location83165920-83200117 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 83195069 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 948 (R948*)
Ref Sequence ENSEMBL: ENSMUSP00000109552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]
Predicted Effect probably null
Transcript: ENSMUST00000077407
AA Change: R911*
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: R911*

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113907
AA Change: R814*
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: R814*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113913
AA Change: R931*
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: R931*

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113918
AA Change: R948*
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: R948*

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113919
AA Change: R948*
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: R948*

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83179897 missense probably benign 0.00
IGL01450:Dctn1 APN 6 83194110 unclassified probably benign
IGL01876:Dctn1 APN 6 83197921 missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83191344 missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83182722 missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83191048 missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83189914 missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83192514 missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83182708 missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83192493 missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83197484 splice site probably benign
IGL03394:Dctn1 APN 6 83191284 missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83194174 missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83197369 intron probably benign
PIT4812001:Dctn1 UTSW 6 83199762 missense possibly damaging 0.86
R0044:Dctn1 UTSW 6 83191134 missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0057:Dctn1 UTSW 6 83179892 missense probably benign 0.14
R0731:Dctn1 UTSW 6 83183089 missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83190107 critical splice donor site probably null
R0755:Dctn1 UTSW 6 83189077 missense probably damaging 0.96
R0839:Dctn1 UTSW 6 83190477 missense possibly damaging 0.53
R1035:Dctn1 UTSW 6 83190220 missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83197508 missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83195082 missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83197596 missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83192518 missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83199184 splice site probably benign
R2008:Dctn1 UTSW 6 83189956 missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83199705 missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83197586 missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83199800 missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83194187 missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83195049 missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83189938 missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83189937 missense probably benign 0.24
R4819:Dctn1 UTSW 6 83190519 missense probably damaging 0.97
R4831:Dctn1 UTSW 6 83199771 missense possibly damaging 0.46
R4928:Dctn1 UTSW 6 83189207 missense possibly damaging 0.73
R5087:Dctn1 UTSW 6 83191639 missense probably damaging 1.00
R5354:Dctn1 UTSW 6 83183126 missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83190210 missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83197949 critical splice donor site probably null
R5856:Dctn1 UTSW 6 83197865 missense probably damaging 1.00
R6025:Dctn1 UTSW 6 83193691 intron probably null
R6999:Dctn1 UTSW 6 83191281 missense possibly damaging 0.89
R7052:Dctn1 UTSW 6 83195280 intron probably null
R7133:Dctn1 UTSW 6 83180044 intron probably null
R7485:Dctn1 UTSW 6 83189905 missense possibly damaging 0.85
R7729:Dctn1 UTSW 6 83183060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCTAGAAACCAGGGTG -3'
(R):5'- ACACTAGACAGCCTTTACCTTAACTG -3'

Sequencing Primer
(F):5'- GCCTAGAAACCAGGGTGATTTTCC -3'
(R):5'- GTGTTCCTGGTGCCCTCAAAG -3'
Posted On2019-10-24