Incidental Mutation 'R7607:Exoc6b'
ID 588365
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Name exocyst complex component 6B
Synonyms Sec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
MMRRC Submission 045677-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 84595469-85046495 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84966391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 194 (K194N)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197] [ENSMUST00000162821]
AlphaFold A6H5Z3
Predicted Effect possibly damaging
Transcript: ENSMUST00000160197
AA Change: K194N

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: K194N

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162821
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,128,383 (GRCm39) H30Q probably damaging Het
A930009A15Rik G A 10: 115,417,894 (GRCm39) probably null Het
Abca7 T C 10: 79,847,667 (GRCm39) L1779P probably damaging Het
Aff1 G A 5: 103,997,325 (GRCm39) V1140I possibly damaging Het
Ano2 C T 6: 125,689,382 (GRCm39) A169V probably damaging Het
Atat1 T C 17: 36,219,999 (GRCm39) Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,255 (GRCm39) probably null Het
Atp7b T G 8: 22,501,522 (GRCm39) K912T probably damaging Het
Ceacam14 T C 7: 17,548,246 (GRCm39) V112A possibly damaging Het
Cfap107 T A 4: 144,146,332 (GRCm39) H107L probably damaging Het
Cobll1 T C 2: 64,926,201 (GRCm39) N1119S probably benign Het
Csmd1 G T 8: 15,968,331 (GRCm39) Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,921,791 (GRCm39) V381A possibly damaging Het
Dctn1 C T 6: 83,172,051 (GRCm39) R948* probably null Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Esrp1 A G 4: 11,384,449 (GRCm39) V78A probably damaging Het
Evc2 A G 5: 37,544,200 (GRCm39) T650A possibly damaging Het
Fer1l6 G A 15: 58,534,581 (GRCm39) W1809* probably null Het
Frmd4a T A 2: 4,596,747 (GRCm39) L156* probably null Het
Gk5 A T 9: 96,035,263 (GRCm39) probably null Het
Gm3573 A G 14: 42,011,707 (GRCm39) F8L probably benign Het
Gm9767 G A 10: 25,954,838 (GRCm39) C130Y unknown Het
Grip2 T C 6: 91,765,393 (GRCm39) T30A probably benign Het
Gskip C A 12: 105,665,156 (GRCm39) A65E possibly damaging Het
Gtf2e2 A G 8: 34,266,493 (GRCm39) R259G probably benign Het
Gucy1b2 T A 14: 62,656,626 (GRCm39) I244F probably damaging Het
Gxylt2 G T 6: 100,775,151 (GRCm39) V357L possibly damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igdcc4 C T 9: 65,041,040 (GRCm39) P1024S possibly damaging Het
Ino80 A T 2: 119,212,750 (GRCm39) probably null Het
Knl1 T C 2: 118,925,614 (GRCm39) F1881S possibly damaging Het
Mbd6 T C 10: 127,121,099 (GRCm39) E518G unknown Het
Mlh1 A G 9: 111,058,958 (GRCm39) S689P probably damaging Het
Mmrn2 T C 14: 34,120,897 (GRCm39) I589T possibly damaging Het
Mtmr12 C T 15: 12,257,794 (GRCm39) Q291* probably null Het
Mup8 T A 4: 60,222,035 (GRCm39) I33F probably benign Het
Mylk C T 16: 34,715,184 (GRCm39) P504L probably benign Het
Ntrk3 C T 7: 77,900,621 (GRCm39) A573T probably benign Het
Obscn G T 11: 58,889,091 (GRCm39) S7560R unknown Het
Or1m1 A G 9: 18,666,178 (GRCm39) F251S possibly damaging Het
Or52z12 A C 7: 103,234,137 (GRCm39) T303P probably damaging Het
Pde1c T C 6: 56,127,613 (GRCm39) T391A probably damaging Het
Pla2g4d T A 2: 120,119,457 (GRCm39) H19L probably benign Het
Plce1 C A 19: 38,513,196 (GRCm39) A165E probably benign Het
Polr1a T C 6: 71,890,005 (GRCm39) S75P probably benign Het
Psg21 T C 7: 18,388,708 (GRCm39) E128G probably benign Het
Radil A G 5: 142,492,368 (GRCm39) I420T probably damaging Het
Radil A T 5: 142,480,550 (GRCm39) M635K probably damaging Het
Rnase11 G A 14: 51,287,029 (GRCm39) T175I probably damaging Het
Robo1 C T 16: 72,360,626 (GRCm39) P13S Het
Slc18a2 C A 19: 59,272,790 (GRCm39) A364D probably benign Het
Snph C T 2: 151,436,506 (GRCm39) D141N probably damaging Het
Snrnp70 T C 7: 45,041,688 (GRCm39) K70R possibly damaging Het
Snx33 T C 9: 56,833,997 (GRCm39) D24G probably benign Het
Spag6 T A 2: 18,736,773 (GRCm39) D165E possibly damaging Het
Spata31 T G 13: 65,069,406 (GRCm39) L518R probably damaging Het
Spata31e3 T C 13: 50,404,296 (GRCm39) E2G possibly damaging Het
Sspo G A 6: 48,466,661 (GRCm39) V4059M probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stoml1 A G 9: 58,163,941 (GRCm39) R87G probably damaging Het
Suv39h2 T C 2: 3,475,866 (GRCm39) T40A unknown Het
Terb2 G T 2: 122,016,956 (GRCm39) G26W probably damaging Het
Tmem62 T C 2: 120,826,921 (GRCm39) I406T probably benign Het
Tnfrsf11a G A 1: 105,772,458 (GRCm39) V582I probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Unc13c T C 9: 73,576,817 (GRCm39) D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r48 C A 6: 90,012,962 (GRCm39) V288L probably benign Het
Vmn2r13 A G 5: 109,321,506 (GRCm39) V397A probably damaging Het
Vmn2r98 A G 17: 19,287,570 (GRCm39) N468D possibly damaging Het
Zfhx2 G T 14: 55,303,688 (GRCm39) T1432K possibly damaging Het
Zswim5 T A 4: 116,843,939 (GRCm39) D992E possibly damaging Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84,966,435 (GRCm39) missense probably benign 0.08
IGL01148:Exoc6b APN 6 84,885,208 (GRCm39) missense probably benign 0.18
IGL01804:Exoc6b APN 6 84,885,148 (GRCm39) missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85,046,320 (GRCm39) missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84,602,156 (GRCm39) missense probably damaging 1.00
IGL02441:Exoc6b APN 6 84,981,990 (GRCm39) missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84,835,411 (GRCm39) missense probably benign
IGL02996:Exoc6b APN 6 84,885,195 (GRCm39) missense probably benign 0.01
IGL03132:Exoc6b APN 6 84,768,246 (GRCm39) missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84,821,112 (GRCm39) missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84,831,681 (GRCm39) critical splice donor site probably null
R0732:Exoc6b UTSW 6 84,832,504 (GRCm39) missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84,885,205 (GRCm39) missense probably benign
R1381:Exoc6b UTSW 6 84,812,099 (GRCm39) missense probably benign
R1723:Exoc6b UTSW 6 85,046,326 (GRCm39) missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84,830,660 (GRCm39) missense probably benign 0.04
R1866:Exoc6b UTSW 6 84,828,896 (GRCm39) missense probably damaging 0.99
R2122:Exoc6b UTSW 6 84,598,464 (GRCm39) missense probably benign 0.01
R2138:Exoc6b UTSW 6 84,966,464 (GRCm39) missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84,966,321 (GRCm39) missense possibly damaging 0.60
R2987:Exoc6b UTSW 6 84,828,929 (GRCm39) missense probably damaging 0.96
R2988:Exoc6b UTSW 6 84,828,929 (GRCm39) missense probably damaging 0.96
R3415:Exoc6b UTSW 6 84,867,547 (GRCm39) missense possibly damaging 0.81
R3417:Exoc6b UTSW 6 84,867,547 (GRCm39) missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 84,980,161 (GRCm39) intron probably benign
R4610:Exoc6b UTSW 6 84,980,141 (GRCm39) intron probably benign
R4624:Exoc6b UTSW 6 84,831,791 (GRCm39) splice site probably benign
R4845:Exoc6b UTSW 6 84,812,119 (GRCm39) missense probably benign 0.04
R5366:Exoc6b UTSW 6 84,867,513 (GRCm39) missense probably benign
R5603:Exoc6b UTSW 6 84,812,126 (GRCm39) missense possibly damaging 0.96
R5635:Exoc6b UTSW 6 84,828,909 (GRCm39) missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84,837,173 (GRCm39) missense probably damaging 1.00
R6188:Exoc6b UTSW 6 84,832,479 (GRCm39) missense probably damaging 0.99
R7030:Exoc6b UTSW 6 84,825,807 (GRCm39) missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84,831,704 (GRCm39) missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84,825,792 (GRCm39) missense probably benign 0.40
R7574:Exoc6b UTSW 6 84,768,366 (GRCm39) critical splice acceptor site probably null
R7918:Exoc6b UTSW 6 85,046,332 (GRCm39) missense probably damaging 0.96
R8146:Exoc6b UTSW 6 84,885,176 (GRCm39) missense probably benign 0.00
R8204:Exoc6b UTSW 6 84,832,504 (GRCm39) missense probably damaging 1.00
R8356:Exoc6b UTSW 6 84,821,077 (GRCm39) frame shift probably null
R8456:Exoc6b UTSW 6 84,821,077 (GRCm39) frame shift probably null
R9099:Exoc6b UTSW 6 84,982,000 (GRCm39) missense possibly damaging 0.88
R9608:Exoc6b UTSW 6 84,602,106 (GRCm39) critical splice donor site probably null
R9620:Exoc6b UTSW 6 84,988,302 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACGGACCTTCCTAAAATGAGTTAAG -3'
(R):5'- TGTACAACAAAAGCTAATCGAGGTTAG -3'

Sequencing Primer
(F):5'- AGAAGTAATTAACATACTTGCCAAGG -3'
(R):5'- ACTGGAGCATCTGGAACA -3'
Posted On 2019-10-24