Incidental Mutation 'R7607:Exoc6b'
ID588365
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Nameexocyst complex component 6B
SynonymsSec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R7607 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location84618487-85069513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84989409 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 194 (K194N)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197] [ENSMUST00000162821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160197
AA Change: K194N

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: K194N

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162821
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84989453 missense probably benign 0.08
IGL01148:Exoc6b APN 6 84908226 missense probably benign 0.18
IGL01804:Exoc6b APN 6 84908166 missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85069338 missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84625174 missense probably damaging 1.00
IGL02441:Exoc6b APN 6 85005008 missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84858429 missense probably benign
IGL02996:Exoc6b APN 6 84908213 missense probably benign 0.01
IGL03132:Exoc6b APN 6 84791264 missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84844130 missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84854699 critical splice donor site probably null
R0732:Exoc6b UTSW 6 84855522 missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84908223 missense probably benign
R1381:Exoc6b UTSW 6 84835117 missense probably benign
R1723:Exoc6b UTSW 6 85069344 missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84853678 missense probably benign 0.04
R1866:Exoc6b UTSW 6 84851914 missense probably damaging 0.99
R2122:Exoc6b UTSW 6 84621482 missense probably benign 0.01
R2138:Exoc6b UTSW 6 84989482 missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84989339 missense possibly damaging 0.60
R2987:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R2988:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R3415:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R3417:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 85003179 intron probably benign
R4610:Exoc6b UTSW 6 85003159 intron probably benign
R4624:Exoc6b UTSW 6 84854809 splice site probably benign
R4845:Exoc6b UTSW 6 84835137 missense probably benign 0.04
R5366:Exoc6b UTSW 6 84890531 missense probably benign
R5603:Exoc6b UTSW 6 84835144 missense possibly damaging 0.96
R5635:Exoc6b UTSW 6 84851927 missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84860191 missense probably damaging 1.00
R6188:Exoc6b UTSW 6 84855497 missense probably damaging 0.99
R7030:Exoc6b UTSW 6 84848825 missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84854722 missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84848810 missense probably benign 0.40
R7574:Exoc6b UTSW 6 84791384 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GACGGACCTTCCTAAAATGAGTTAAG -3'
(R):5'- TGTACAACAAAAGCTAATCGAGGTTAG -3'

Sequencing Primer
(F):5'- AGAAGTAATTAACATACTTGCCAAGG -3'
(R):5'- ACTGGAGCATCTGGAACA -3'
Posted On2019-10-24