Incidental Mutation 'R7607:Grip2'
ID588367
Institutional Source Beutler Lab
Gene Symbol Grip2
Ensembl Gene ENSMUSG00000030098
Gene Nameglutamate receptor interacting protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7607 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location91761509-91827250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91788412 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000124709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159684] [ENSMUST00000161566] [ENSMUST00000162293] [ENSMUST00000162300]
Predicted Effect probably benign
Transcript: ENSMUST00000159684
AA Change: T30A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125047
Gene: ENSMUSG00000030098
AA Change: T30A

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 385 390 N/A INTRINSIC
PDZ 426 506 2.18e-15 SMART
PDZ 527 602 3.86e-16 SMART
PDZ 625 699 1.38e-17 SMART
low complexity region 778 793 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
PDZ 910 982 2.95e-12 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125538
Gene: ENSMUSG00000030098
AA Change: T26A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
PDB:2QT5|B 42 89 3e-9 PDB
SCOP:d1lcya1 47 89 2e-7 SMART
low complexity region 103 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161566
AA Change: T30A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123941
Gene: ENSMUSG00000030098
AA Change: T30A

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 9.96e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162293
SMART Domains Protein: ENSMUSP00000124717
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
PDZ 10 84 1.12e-12 SMART
PDZ 109 187 3.8e-15 SMART
PDZ 210 285 7.9e-13 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 374 379 N/A INTRINSIC
PDZ 415 495 2.18e-15 SMART
PDZ 516 591 3.86e-16 SMART
PDZ 614 688 1.38e-17 SMART
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162300
AA Change: T30A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124709
Gene: ENSMUSG00000030098
AA Change: T30A

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 388 400 N/A INTRINSIC
low complexity region 426 431 N/A INTRINSIC
PDZ 467 547 2.18e-15 SMART
PDZ 568 643 3.86e-16 SMART
PDZ 666 740 1.38e-17 SMART
low complexity region 819 834 N/A INTRINSIC
low complexity region 908 919 N/A INTRINSIC
PDZ 951 1023 2.95e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are born in numbers expected by the Mendelian ratio and show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Grip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Grip2 APN 6 91782897 missense probably benign 0.00
IGL01748:Grip2 APN 6 91764743 missense probably damaging 1.00
IGL01838:Grip2 APN 6 91764763 missense possibly damaging 0.92
IGL02392:Grip2 APN 6 91787295 missense probably damaging 1.00
IGL02620:Grip2 APN 6 91778606 missense possibly damaging 0.93
IGL02862:Grip2 APN 6 91788104 missense probably damaging 0.98
IGL03027:Grip2 APN 6 91778871 missense probably benign 0.02
IGL03180:Grip2 APN 6 91785761 splice site probably benign
R0265:Grip2 UTSW 6 91773792 critical splice donor site probably null
R0448:Grip2 UTSW 6 91779213 missense probably damaging 1.00
R0597:Grip2 UTSW 6 91796197 intron probably benign
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1664:Grip2 UTSW 6 91765252 missense probably damaging 1.00
R1703:Grip2 UTSW 6 91777398 missense probably damaging 1.00
R1793:Grip2 UTSW 6 91783642 missense probably benign 0.03
R1951:Grip2 UTSW 6 91783848 missense probably damaging 1.00
R2001:Grip2 UTSW 6 91779850 missense probably benign 0.00
R4730:Grip2 UTSW 6 91785712 makesense probably null
R4754:Grip2 UTSW 6 91779182 missense probably damaging 1.00
R4754:Grip2 UTSW 6 91779192 missense probably damaging 0.97
R4773:Grip2 UTSW 6 91782432 missense possibly damaging 0.80
R5135:Grip2 UTSW 6 91773916 missense possibly damaging 0.89
R5213:Grip2 UTSW 6 91779831 missense probably benign 0.04
R5972:Grip2 UTSW 6 91807281 missense probably benign 0.01
R6176:Grip2 UTSW 6 91779851 missense probably benign 0.00
R6188:Grip2 UTSW 6 91763533 missense probably damaging 1.00
R6289:Grip2 UTSW 6 91778871 missense probably benign 0.02
R6345:Grip2 UTSW 6 91765388 missense possibly damaging 0.91
R6348:Grip2 UTSW 6 91780438 missense probably damaging 0.99
R6394:Grip2 UTSW 6 91787201 missense probably damaging 1.00
R6658:Grip2 UTSW 6 91786491 missense probably damaging 1.00
R7065:Grip2 UTSW 6 91783569 critical splice donor site probably null
R7074:Grip2 UTSW 6 91784708 missense probably benign 0.24
R7308:Grip2 UTSW 6 91778688 missense possibly damaging 0.74
R7617:Grip2 UTSW 6 91765050 intron probably null
RF003:Grip2 UTSW 6 91783593 missense probably benign 0.02
Z1176:Grip2 UTSW 6 91763510 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTCTGCCACTTTATGCTGGG -3'
(R):5'- AGATTGGCTGAGAAGCTGC -3'

Sequencing Primer
(F):5'- GTGGCATCACCCTCCAC -3'
(R):5'- TGAGAAGCTGCCCACATG -3'
Posted On2019-10-24