Incidental Mutation 'R7607:Ano2'
ID588369
Institutional Source Beutler Lab
Gene Symbol Ano2
Ensembl Gene ENSMUSG00000038115
Gene Nameanoctamin 2
SynonymsTmem16b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7607 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125690419-126040126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125712419 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 169 (A169V)
Ref Sequence ENSEMBL: ENSMUSP00000125303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160496]
Predicted Effect probably damaging
Transcript: ENSMUST00000160496
AA Change: A169V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115
AA Change: A169V

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161619
AA Change: A138V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125426
Gene: ENSMUSG00000038115
AA Change: A138V

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:Anoctamin 262 425 1.9e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack calcium-activated chloride currents in the main olfactory epithelium and vomeronasal organ but normal olfaction in behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Ano2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ano2 APN 6 126013253 missense probably damaging 1.00
IGL01387:Ano2 APN 6 126013277 missense probably damaging 0.99
IGL01772:Ano2 APN 6 126036858 missense probably damaging 0.98
IGL01931:Ano2 APN 6 125982745 missense probably damaging 1.00
IGL02066:Ano2 APN 6 125690739 missense probably benign 0.07
IGL02410:Ano2 APN 6 125815533 critical splice acceptor site probably null
IGL02526:Ano2 APN 6 125872751 critical splice donor site probably null
IGL03116:Ano2 APN 6 125980171 nonsense probably null
IGL03183:Ano2 APN 6 125710629 missense probably benign
IGL03391:Ano2 APN 6 125807839 missense probably damaging 1.00
R0257:Ano2 UTSW 6 125880713 missense probably benign 0.05
R0462:Ano2 UTSW 6 125712275 missense probably benign 0.26
R0594:Ano2 UTSW 6 125982765 missense probably damaging 1.00
R1072:Ano2 UTSW 6 126039324 missense probably damaging 1.00
R1099:Ano2 UTSW 6 125807847 missense probably damaging 1.00
R1436:Ano2 UTSW 6 125867171 critical splice donor site probably null
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1822:Ano2 UTSW 6 125863457 missense probably damaging 1.00
R1901:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1902:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1911:Ano2 UTSW 6 126013691 missense probably benign 0.00
R2040:Ano2 UTSW 6 126039508 missense probably benign 0.13
R2192:Ano2 UTSW 6 126015539 missense probably damaging 1.00
R2307:Ano2 UTSW 6 125992886 missense probably benign 0.00
R2698:Ano2 UTSW 6 125712346 missense probably benign 0.01
R2878:Ano2 UTSW 6 125863518 missense probably damaging 1.00
R3151:Ano2 UTSW 6 126013317 splice site probably null
R4004:Ano2 UTSW 6 126013279 missense probably damaging 1.00
R4664:Ano2 UTSW 6 125863538 missense probably benign 0.07
R4684:Ano2 UTSW 6 125790341 missense probably benign 0.00
R4685:Ano2 UTSW 6 125980124 nonsense probably null
R4686:Ano2 UTSW 6 125790291 missense probably benign 0.10
R4852:Ano2 UTSW 6 125982923 missense possibly damaging 0.95
R4923:Ano2 UTSW 6 125903055 utr 3 prime probably benign
R5488:Ano2 UTSW 6 126039253 missense possibly damaging 0.46
R5513:Ano2 UTSW 6 126039322 missense possibly damaging 0.88
R5699:Ano2 UTSW 6 125872740 missense probably damaging 1.00
R5876:Ano2 UTSW 6 126039279 missense possibly damaging 0.92
R6175:Ano2 UTSW 6 125992955 missense probably benign 0.15
R6219:Ano2 UTSW 6 125815590 missense probably damaging 1.00
R6613:Ano2 UTSW 6 125806656 splice site probably null
R6711:Ano2 UTSW 6 125775832 missense probably damaging 1.00
R6982:Ano2 UTSW 6 125992893 missense probably benign
R7153:Ano2 UTSW 6 125992943 missense possibly damaging 0.73
R7182:Ano2 UTSW 6 125790293 missense probably damaging 0.99
R7312:Ano2 UTSW 6 126039497 nonsense probably null
R7358:Ano2 UTSW 6 125710733 missense probably benign
R7456:Ano2 UTSW 6 125963545 missense probably benign 0.01
R7532:Ano2 UTSW 6 125963704 missense probably damaging 1.00
R7623:Ano2 UTSW 6 126015573 nonsense probably null
R7690:Ano2 UTSW 6 126013198 missense probably damaging 1.00
R8273:Ano2 UTSW 6 125982720 missense probably damaging 1.00
R8389:Ano2 UTSW 6 125980169 missense probably damaging 0.99
R8392:Ano2 UTSW 6 125880735 missense probably benign 0.02
R8479:Ano2 UTSW 6 125712160 missense possibly damaging 0.61
R8488:Ano2 UTSW 6 125980170 missense probably damaging 1.00
R8746:Ano2 UTSW 6 125863550 missense probably benign 0.14
Z1176:Ano2 UTSW 6 125710707 missense probably benign
Z1176:Ano2 UTSW 6 125863453 nonsense probably null
Z1177:Ano2 UTSW 6 126013207 missense probably damaging 1.00
Z1177:Ano2 UTSW 6 126015647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACGACAACCAGAGGAAAG -3'
(R):5'- TACCAAAACTCTGCTGCAAGG -3'

Sequencing Primer
(F):5'- AGTCGACTATGTACTTGCATACCAC -3'
(R):5'- ACTCTGCTGCAAGGCCCTG -3'
Posted On2019-10-24