Incidental Mutation 'R7607:Ano2'
ID 588369
Institutional Source Beutler Lab
Gene Symbol Ano2
Ensembl Gene ENSMUSG00000038115
Gene Name anoctamin 2
Synonyms Tmem16b
MMRRC Submission 045677-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 125667382-126017089 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 125689382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 169 (A169V)
Ref Sequence ENSEMBL: ENSMUSP00000125303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160496]
AlphaFold Q8CFW1
Predicted Effect probably damaging
Transcript: ENSMUST00000160496
AA Change: A169V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115
AA Change: A169V

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161619
AA Change: A138V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125426
Gene: ENSMUSG00000038115
AA Change: A138V

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:Anoctamin 262 425 1.9e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack calcium-activated chloride currents in the main olfactory epithelium and vomeronasal organ but normal olfaction in behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,128,383 (GRCm39) H30Q probably damaging Het
A930009A15Rik G A 10: 115,417,894 (GRCm39) probably null Het
Abca7 T C 10: 79,847,667 (GRCm39) L1779P probably damaging Het
Aff1 G A 5: 103,997,325 (GRCm39) V1140I possibly damaging Het
Atat1 T C 17: 36,219,999 (GRCm39) Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,255 (GRCm39) probably null Het
Atp7b T G 8: 22,501,522 (GRCm39) K912T probably damaging Het
Ceacam14 T C 7: 17,548,246 (GRCm39) V112A possibly damaging Het
Cfap107 T A 4: 144,146,332 (GRCm39) H107L probably damaging Het
Cobll1 T C 2: 64,926,201 (GRCm39) N1119S probably benign Het
Csmd1 G T 8: 15,968,331 (GRCm39) Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,921,791 (GRCm39) V381A possibly damaging Het
Dctn1 C T 6: 83,172,051 (GRCm39) R948* probably null Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Esrp1 A G 4: 11,384,449 (GRCm39) V78A probably damaging Het
Evc2 A G 5: 37,544,200 (GRCm39) T650A possibly damaging Het
Exoc6b T A 6: 84,966,391 (GRCm39) K194N possibly damaging Het
Fer1l6 G A 15: 58,534,581 (GRCm39) W1809* probably null Het
Frmd4a T A 2: 4,596,747 (GRCm39) L156* probably null Het
Gk5 A T 9: 96,035,263 (GRCm39) probably null Het
Gm3573 A G 14: 42,011,707 (GRCm39) F8L probably benign Het
Gm9767 G A 10: 25,954,838 (GRCm39) C130Y unknown Het
Grip2 T C 6: 91,765,393 (GRCm39) T30A probably benign Het
Gskip C A 12: 105,665,156 (GRCm39) A65E possibly damaging Het
Gtf2e2 A G 8: 34,266,493 (GRCm39) R259G probably benign Het
Gucy1b2 T A 14: 62,656,626 (GRCm39) I244F probably damaging Het
Gxylt2 G T 6: 100,775,151 (GRCm39) V357L possibly damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igdcc4 C T 9: 65,041,040 (GRCm39) P1024S possibly damaging Het
Ino80 A T 2: 119,212,750 (GRCm39) probably null Het
Knl1 T C 2: 118,925,614 (GRCm39) F1881S possibly damaging Het
Mbd6 T C 10: 127,121,099 (GRCm39) E518G unknown Het
Mlh1 A G 9: 111,058,958 (GRCm39) S689P probably damaging Het
Mmrn2 T C 14: 34,120,897 (GRCm39) I589T possibly damaging Het
Mtmr12 C T 15: 12,257,794 (GRCm39) Q291* probably null Het
Mup8 T A 4: 60,222,035 (GRCm39) I33F probably benign Het
Mylk C T 16: 34,715,184 (GRCm39) P504L probably benign Het
Ntrk3 C T 7: 77,900,621 (GRCm39) A573T probably benign Het
Obscn G T 11: 58,889,091 (GRCm39) S7560R unknown Het
Or1m1 A G 9: 18,666,178 (GRCm39) F251S possibly damaging Het
Or52z12 A C 7: 103,234,137 (GRCm39) T303P probably damaging Het
Pde1c T C 6: 56,127,613 (GRCm39) T391A probably damaging Het
Pla2g4d T A 2: 120,119,457 (GRCm39) H19L probably benign Het
Plce1 C A 19: 38,513,196 (GRCm39) A165E probably benign Het
Polr1a T C 6: 71,890,005 (GRCm39) S75P probably benign Het
Psg21 T C 7: 18,388,708 (GRCm39) E128G probably benign Het
Radil A G 5: 142,492,368 (GRCm39) I420T probably damaging Het
Radil A T 5: 142,480,550 (GRCm39) M635K probably damaging Het
Rnase11 G A 14: 51,287,029 (GRCm39) T175I probably damaging Het
Robo1 C T 16: 72,360,626 (GRCm39) P13S Het
Slc18a2 C A 19: 59,272,790 (GRCm39) A364D probably benign Het
Snph C T 2: 151,436,506 (GRCm39) D141N probably damaging Het
Snrnp70 T C 7: 45,041,688 (GRCm39) K70R possibly damaging Het
Snx33 T C 9: 56,833,997 (GRCm39) D24G probably benign Het
Spag6 T A 2: 18,736,773 (GRCm39) D165E possibly damaging Het
Spata31 T G 13: 65,069,406 (GRCm39) L518R probably damaging Het
Spata31e3 T C 13: 50,404,296 (GRCm39) E2G possibly damaging Het
Sspo G A 6: 48,466,661 (GRCm39) V4059M probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stoml1 A G 9: 58,163,941 (GRCm39) R87G probably damaging Het
Suv39h2 T C 2: 3,475,866 (GRCm39) T40A unknown Het
Terb2 G T 2: 122,016,956 (GRCm39) G26W probably damaging Het
Tmem62 T C 2: 120,826,921 (GRCm39) I406T probably benign Het
Tnfrsf11a G A 1: 105,772,458 (GRCm39) V582I probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Unc13c T C 9: 73,576,817 (GRCm39) D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r48 C A 6: 90,012,962 (GRCm39) V288L probably benign Het
Vmn2r13 A G 5: 109,321,506 (GRCm39) V397A probably damaging Het
Vmn2r98 A G 17: 19,287,570 (GRCm39) N468D possibly damaging Het
Zfhx2 G T 14: 55,303,688 (GRCm39) T1432K possibly damaging Het
Zswim5 T A 4: 116,843,939 (GRCm39) D992E possibly damaging Het
Other mutations in Ano2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ano2 APN 6 125,990,216 (GRCm39) missense probably damaging 1.00
IGL01387:Ano2 APN 6 125,990,240 (GRCm39) missense probably damaging 0.99
IGL01772:Ano2 APN 6 126,013,821 (GRCm39) missense probably damaging 0.98
IGL01931:Ano2 APN 6 125,959,708 (GRCm39) missense probably damaging 1.00
IGL02066:Ano2 APN 6 125,667,702 (GRCm39) missense probably benign 0.07
IGL02410:Ano2 APN 6 125,792,496 (GRCm39) critical splice acceptor site probably null
IGL02526:Ano2 APN 6 125,849,714 (GRCm39) critical splice donor site probably null
IGL03116:Ano2 APN 6 125,957,134 (GRCm39) nonsense probably null
IGL03183:Ano2 APN 6 125,687,592 (GRCm39) missense probably benign
IGL03391:Ano2 APN 6 125,784,802 (GRCm39) missense probably damaging 1.00
R0257:Ano2 UTSW 6 125,857,676 (GRCm39) missense probably benign 0.05
R0462:Ano2 UTSW 6 125,689,238 (GRCm39) missense probably benign 0.26
R0594:Ano2 UTSW 6 125,959,728 (GRCm39) missense probably damaging 1.00
R1072:Ano2 UTSW 6 126,016,287 (GRCm39) missense probably damaging 1.00
R1099:Ano2 UTSW 6 125,784,810 (GRCm39) missense probably damaging 1.00
R1436:Ano2 UTSW 6 125,844,134 (GRCm39) critical splice donor site probably null
R1468:Ano2 UTSW 6 125,773,227 (GRCm39) missense probably damaging 1.00
R1468:Ano2 UTSW 6 125,773,227 (GRCm39) missense probably damaging 1.00
R1822:Ano2 UTSW 6 125,840,420 (GRCm39) missense probably damaging 1.00
R1901:Ano2 UTSW 6 125,849,647 (GRCm39) missense probably damaging 1.00
R1902:Ano2 UTSW 6 125,849,647 (GRCm39) missense probably damaging 1.00
R1911:Ano2 UTSW 6 125,990,654 (GRCm39) missense probably benign 0.00
R2040:Ano2 UTSW 6 126,016,471 (GRCm39) missense probably benign 0.13
R2192:Ano2 UTSW 6 125,992,502 (GRCm39) missense probably damaging 1.00
R2307:Ano2 UTSW 6 125,969,849 (GRCm39) missense probably benign 0.00
R2698:Ano2 UTSW 6 125,689,309 (GRCm39) missense probably benign 0.01
R2878:Ano2 UTSW 6 125,840,481 (GRCm39) missense probably damaging 1.00
R3151:Ano2 UTSW 6 125,990,280 (GRCm39) splice site probably null
R4004:Ano2 UTSW 6 125,990,242 (GRCm39) missense probably damaging 1.00
R4664:Ano2 UTSW 6 125,840,501 (GRCm39) missense probably benign 0.07
R4684:Ano2 UTSW 6 125,767,304 (GRCm39) missense probably benign 0.00
R4685:Ano2 UTSW 6 125,957,087 (GRCm39) nonsense probably null
R4686:Ano2 UTSW 6 125,767,254 (GRCm39) missense probably benign 0.10
R4852:Ano2 UTSW 6 125,959,886 (GRCm39) missense possibly damaging 0.95
R4923:Ano2 UTSW 6 125,880,018 (GRCm39) utr 3 prime probably benign
R5488:Ano2 UTSW 6 126,016,216 (GRCm39) missense possibly damaging 0.46
R5513:Ano2 UTSW 6 126,016,285 (GRCm39) missense possibly damaging 0.88
R5699:Ano2 UTSW 6 125,849,703 (GRCm39) missense probably damaging 1.00
R5876:Ano2 UTSW 6 126,016,242 (GRCm39) missense possibly damaging 0.92
R6175:Ano2 UTSW 6 125,969,918 (GRCm39) missense probably benign 0.15
R6219:Ano2 UTSW 6 125,792,553 (GRCm39) missense probably damaging 1.00
R6613:Ano2 UTSW 6 125,783,619 (GRCm39) splice site probably null
R6711:Ano2 UTSW 6 125,752,795 (GRCm39) missense probably damaging 1.00
R6982:Ano2 UTSW 6 125,969,856 (GRCm39) missense probably benign
R7153:Ano2 UTSW 6 125,969,906 (GRCm39) missense possibly damaging 0.73
R7182:Ano2 UTSW 6 125,767,256 (GRCm39) missense probably damaging 0.99
R7312:Ano2 UTSW 6 126,016,460 (GRCm39) nonsense probably null
R7358:Ano2 UTSW 6 125,687,696 (GRCm39) missense probably benign
R7456:Ano2 UTSW 6 125,940,508 (GRCm39) missense probably benign 0.01
R7532:Ano2 UTSW 6 125,940,667 (GRCm39) missense probably damaging 1.00
R7623:Ano2 UTSW 6 125,992,536 (GRCm39) nonsense probably null
R7690:Ano2 UTSW 6 125,990,161 (GRCm39) missense probably damaging 1.00
R8273:Ano2 UTSW 6 125,959,683 (GRCm39) missense probably damaging 1.00
R8389:Ano2 UTSW 6 125,957,132 (GRCm39) missense probably damaging 0.99
R8392:Ano2 UTSW 6 125,857,698 (GRCm39) missense probably benign 0.02
R8479:Ano2 UTSW 6 125,689,123 (GRCm39) missense possibly damaging 0.61
R8488:Ano2 UTSW 6 125,957,133 (GRCm39) missense probably damaging 1.00
R8746:Ano2 UTSW 6 125,840,513 (GRCm39) missense probably benign 0.14
R9136:Ano2 UTSW 6 125,959,962 (GRCm39) missense probably damaging 0.98
R9680:Ano2 UTSW 6 125,857,382 (GRCm39) critical splice acceptor site probably null
R9752:Ano2 UTSW 6 125,840,499 (GRCm39) missense probably damaging 1.00
Z1176:Ano2 UTSW 6 125,840,416 (GRCm39) nonsense probably null
Z1176:Ano2 UTSW 6 125,687,670 (GRCm39) missense probably benign
Z1177:Ano2 UTSW 6 125,992,610 (GRCm39) missense probably damaging 1.00
Z1177:Ano2 UTSW 6 125,990,170 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACGACAACCAGAGGAAAG -3'
(R):5'- TACCAAAACTCTGCTGCAAGG -3'

Sequencing Primer
(F):5'- AGTCGACTATGTACTTGCATACCAC -3'
(R):5'- ACTCTGCTGCAAGGCCCTG -3'
Posted On 2019-10-24