Incidental Mutation 'R7607:Snrnp70'
ID588372
Institutional Source Beutler Lab
Gene Symbol Snrnp70
Ensembl Gene ENSMUSG00000063511
Gene Namesmall nuclear ribonucleoprotein 70 (U1)
SynonymsSrnp70, 2700022N21Rik, Rnulp70, Snrp70, U1-70, 3200002N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7607 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45376453-45395742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45392264 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 70 (K70R)
Ref Sequence ENSEMBL: ENSMUSP00000074160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074575] [ENSMUST00000209858] [ENSMUST00000211121] [ENSMUST00000211378]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074575
AA Change: K70R

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074160
Gene: ENSMUSG00000063511
AA Change: K70R

DomainStartEndE-ValueType
Pfam:U1snRNP70_N 2 94 4e-31 PFAM
RRM 104 177 1.62e-23 SMART
low complexity region 186 203 N/A INTRINSIC
coiled coil region 286 309 N/A INTRINSIC
low complexity region 331 409 N/A INTRINSIC
PDB:3PGW|L 410 448 4e-14 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209858
AA Change: K70R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000209993
AA Change: K19R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211121
AA Change: K70R

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000211378
AA Change: K70R
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a subunit of the U1 snRNP (small nuclear ribonucleic particle), one of at least five snRNPs to comprise the spliceosome, which functions in processing of pre-mRNAs. The U1 snRNP has been shown to be important in defining the 5' splice site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Snrnp70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Snrnp70 APN 7 45377354 critical splice donor site probably null
IGL01092:Snrnp70 APN 7 45377377 missense probably damaging 0.98
IGL01444:Snrnp70 APN 7 45387236 unclassified probably null
IGL03110:Snrnp70 APN 7 45376859 intron probably benign
R0691:Snrnp70 UTSW 7 45387245 missense possibly damaging 0.60
R1371:Snrnp70 UTSW 7 45380705 unclassified probably benign
R1854:Snrnp70 UTSW 7 45377220 nonsense probably null
R1880:Snrnp70 UTSW 7 45377362 intron probably null
R2050:Snrnp70 UTSW 7 45387300 nonsense probably null
R4928:Snrnp70 UTSW 7 45377281 splice site probably null
R5195:Snrnp70 UTSW 7 45394710 missense probably damaging 1.00
R5314:Snrnp70 UTSW 7 45377052 nonsense probably null
R5326:Snrnp70 UTSW 7 45377233 intron probably benign
R5522:Snrnp70 UTSW 7 45377177 intron probably benign
R6182:Snrnp70 UTSW 7 45377073 nonsense probably null
R6739:Snrnp70 UTSW 7 45387419 missense probably damaging 1.00
R7789:Snrnp70 UTSW 7 45376621 nonsense probably null
R7840:Snrnp70 UTSW 7 45376790 missense unknown
R7923:Snrnp70 UTSW 7 45376790 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGAGAACCTTACACATTTTCAGC -3'
(R):5'- CTGGTCAGCATTGGTCCTTG -3'

Sequencing Primer
(F):5'- GAACCTTACACATTTTCAGCTCTGTC -3'
(R):5'- TTGGAGTATACCCAATCTGGACC -3'
Posted On2019-10-24