Incidental Mutation 'R7607:Or52z12'
ID 588374
Institutional Source Beutler Lab
Gene Symbol Or52z12
Ensembl Gene ENSMUSG00000073946
Gene Name olfactory receptor family 52 subfamily Z member 12
Synonyms GA_x6K02T2PBJ9-6306819-6307775, Olfr617, MOR31-10
MMRRC Submission 045677-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103233231-103234187 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 103234137 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 303 (T303P)
Ref Sequence ENSEMBL: ENSMUSP00000149045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048265] [ENSMUST00000215755] [ENSMUST00000216516]
AlphaFold Q8VGA1
Predicted Effect probably damaging
Transcript: ENSMUST00000048265
AA Change: T303P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040319
Gene: ENSMUSG00000073946
AA Change: T303P

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 8.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 41 225 2.3e-10 PFAM
Pfam:7tm_1 47 299 4.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215755
AA Change: T303P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216516
AA Change: T303P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,128,383 (GRCm39) H30Q probably damaging Het
A930009A15Rik G A 10: 115,417,894 (GRCm39) probably null Het
Abca7 T C 10: 79,847,667 (GRCm39) L1779P probably damaging Het
Aff1 G A 5: 103,997,325 (GRCm39) V1140I possibly damaging Het
Ano2 C T 6: 125,689,382 (GRCm39) A169V probably damaging Het
Atat1 T C 17: 36,219,999 (GRCm39) Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,255 (GRCm39) probably null Het
Atp7b T G 8: 22,501,522 (GRCm39) K912T probably damaging Het
Ceacam14 T C 7: 17,548,246 (GRCm39) V112A possibly damaging Het
Cfap107 T A 4: 144,146,332 (GRCm39) H107L probably damaging Het
Cobll1 T C 2: 64,926,201 (GRCm39) N1119S probably benign Het
Csmd1 G T 8: 15,968,331 (GRCm39) Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,921,791 (GRCm39) V381A possibly damaging Het
Dctn1 C T 6: 83,172,051 (GRCm39) R948* probably null Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Esrp1 A G 4: 11,384,449 (GRCm39) V78A probably damaging Het
Evc2 A G 5: 37,544,200 (GRCm39) T650A possibly damaging Het
Exoc6b T A 6: 84,966,391 (GRCm39) K194N possibly damaging Het
Fer1l6 G A 15: 58,534,581 (GRCm39) W1809* probably null Het
Frmd4a T A 2: 4,596,747 (GRCm39) L156* probably null Het
Gk5 A T 9: 96,035,263 (GRCm39) probably null Het
Gm3573 A G 14: 42,011,707 (GRCm39) F8L probably benign Het
Gm9767 G A 10: 25,954,838 (GRCm39) C130Y unknown Het
Grip2 T C 6: 91,765,393 (GRCm39) T30A probably benign Het
Gskip C A 12: 105,665,156 (GRCm39) A65E possibly damaging Het
Gtf2e2 A G 8: 34,266,493 (GRCm39) R259G probably benign Het
Gucy1b2 T A 14: 62,656,626 (GRCm39) I244F probably damaging Het
Gxylt2 G T 6: 100,775,151 (GRCm39) V357L possibly damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igdcc4 C T 9: 65,041,040 (GRCm39) P1024S possibly damaging Het
Ino80 A T 2: 119,212,750 (GRCm39) probably null Het
Knl1 T C 2: 118,925,614 (GRCm39) F1881S possibly damaging Het
Mbd6 T C 10: 127,121,099 (GRCm39) E518G unknown Het
Mlh1 A G 9: 111,058,958 (GRCm39) S689P probably damaging Het
Mmrn2 T C 14: 34,120,897 (GRCm39) I589T possibly damaging Het
Mtmr12 C T 15: 12,257,794 (GRCm39) Q291* probably null Het
Mup8 T A 4: 60,222,035 (GRCm39) I33F probably benign Het
Mylk C T 16: 34,715,184 (GRCm39) P504L probably benign Het
Ntrk3 C T 7: 77,900,621 (GRCm39) A573T probably benign Het
Obscn G T 11: 58,889,091 (GRCm39) S7560R unknown Het
Or1m1 A G 9: 18,666,178 (GRCm39) F251S possibly damaging Het
Pde1c T C 6: 56,127,613 (GRCm39) T391A probably damaging Het
Pla2g4d T A 2: 120,119,457 (GRCm39) H19L probably benign Het
Plce1 C A 19: 38,513,196 (GRCm39) A165E probably benign Het
Polr1a T C 6: 71,890,005 (GRCm39) S75P probably benign Het
Psg21 T C 7: 18,388,708 (GRCm39) E128G probably benign Het
Radil A G 5: 142,492,368 (GRCm39) I420T probably damaging Het
Radil A T 5: 142,480,550 (GRCm39) M635K probably damaging Het
Rnase11 G A 14: 51,287,029 (GRCm39) T175I probably damaging Het
Robo1 C T 16: 72,360,626 (GRCm39) P13S Het
Slc18a2 C A 19: 59,272,790 (GRCm39) A364D probably benign Het
Snph C T 2: 151,436,506 (GRCm39) D141N probably damaging Het
Snrnp70 T C 7: 45,041,688 (GRCm39) K70R possibly damaging Het
Snx33 T C 9: 56,833,997 (GRCm39) D24G probably benign Het
Spag6 T A 2: 18,736,773 (GRCm39) D165E possibly damaging Het
Spata31 T G 13: 65,069,406 (GRCm39) L518R probably damaging Het
Spata31e3 T C 13: 50,404,296 (GRCm39) E2G possibly damaging Het
Sspo G A 6: 48,466,661 (GRCm39) V4059M probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stoml1 A G 9: 58,163,941 (GRCm39) R87G probably damaging Het
Suv39h2 T C 2: 3,475,866 (GRCm39) T40A unknown Het
Terb2 G T 2: 122,016,956 (GRCm39) G26W probably damaging Het
Tmem62 T C 2: 120,826,921 (GRCm39) I406T probably benign Het
Tnfrsf11a G A 1: 105,772,458 (GRCm39) V582I probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Unc13c T C 9: 73,576,817 (GRCm39) D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r48 C A 6: 90,012,962 (GRCm39) V288L probably benign Het
Vmn2r13 A G 5: 109,321,506 (GRCm39) V397A probably damaging Het
Vmn2r98 A G 17: 19,287,570 (GRCm39) N468D possibly damaging Het
Zfhx2 G T 14: 55,303,688 (GRCm39) T1432K possibly damaging Het
Zswim5 T A 4: 116,843,939 (GRCm39) D992E possibly damaging Het
Other mutations in Or52z12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Or52z12 APN 7 103,233,900 (GRCm39) missense probably damaging 1.00
IGL01355:Or52z12 APN 7 103,233,580 (GRCm39) missense probably damaging 1.00
IGL01411:Or52z12 APN 7 103,233,324 (GRCm39) missense probably damaging 1.00
IGL01412:Or52z12 APN 7 103,234,114 (GRCm39) missense probably damaging 1.00
IGL02379:Or52z12 APN 7 103,234,099 (GRCm39) missense possibly damaging 0.84
ANU23:Or52z12 UTSW 7 103,233,900 (GRCm39) missense probably damaging 1.00
IGL03054:Or52z12 UTSW 7 103,234,047 (GRCm39) missense probably benign 0.23
R0536:Or52z12 UTSW 7 103,233,468 (GRCm39) missense probably damaging 1.00
R4222:Or52z12 UTSW 7 103,233,966 (GRCm39) missense probably damaging 1.00
R4224:Or52z12 UTSW 7 103,233,966 (GRCm39) missense probably damaging 1.00
R5342:Or52z12 UTSW 7 103,234,035 (GRCm39) missense probably benign 0.05
R5587:Or52z12 UTSW 7 103,233,738 (GRCm39) missense probably benign 0.07
R5607:Or52z12 UTSW 7 103,233,506 (GRCm39) nonsense probably null
R5608:Or52z12 UTSW 7 103,233,506 (GRCm39) nonsense probably null
R6904:Or52z12 UTSW 7 103,233,727 (GRCm39) missense possibly damaging 0.83
R6929:Or52z12 UTSW 7 103,233,651 (GRCm39) missense probably damaging 0.98
R7399:Or52z12 UTSW 7 103,233,588 (GRCm39) missense possibly damaging 0.78
R7771:Or52z12 UTSW 7 103,233,297 (GRCm39) missense probably benign 0.33
Z1177:Or52z12 UTSW 7 103,234,154 (GRCm39) missense probably benign
Z1177:Or52z12 UTSW 7 103,233,906 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GAATTCCTTCTCGAGATGCCCG -3'
(R):5'- GCTCAAAATTGCTATAATTGCCCTC -3'

Sequencing Primer
(F):5'- CGACTCAAGGCTCTAGGTACTTG -3'
(R):5'- TGCCCTCAGAAATAATGACTTGC -3'
Posted On 2019-10-24