Mutagenetix > Incidental Mutation

Incidental Mutation 'R7607:Zfhx2'

588397

Institutional Source

Beutler Lab

Gene Symbol

Zfhx2

Ensembl Gene

ENSMUSG00000040721

Gene Name

zinc finger homeobox 2

Synonyms

zfh-5

MMRRC Submission

045677-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.232) question?

Stock #

R7607 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55060262-55092324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 55066231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1432 (T1432K)

Ref Sequence

ENSEMBL: ENSMUSP00000045156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036328]

AlphaFold

Q2MHN3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036328
AA Change: T1432K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: T1432K

Domain	Start	End	E-Value	Type
low complexity region	22	42	N/A	INTRINSIC
ZnF_C2H2	230	252	1.43e1	SMART
low complexity region	333	345	N/A	INTRINSIC
low complexity region	428	439	N/A	INTRINSIC
ZnF_C2H2	446	469	8.94e-3	SMART
ZnF_U1	498	532	6.98e-1	SMART
ZnF_C2H2	501	525	3.21e-4	SMART
ZnF_U1	560	594	1.36e0	SMART
ZnF_C2H2	563	587	3.29e-1	SMART
low complexity region	597	623	N/A	INTRINSIC
ZnF_C2H2	752	776	6.4e0	SMART
ZnF_C2H2	815	839	2.02e-1	SMART
ZnF_U1	861	895	1.78e1	SMART
ZnF_C2H2	864	888	5.34e-1	SMART
ZnF_C2H2	974	997	1.51e1	SMART
ZnF_C2H2	1003	1026	1.51e0	SMART
low complexity region	1087	1103	N/A	INTRINSIC
low complexity region	1106	1126	N/A	INTRINSIC
ZnF_U1	1182	1216	3.42e0	SMART
ZnF_C2H2	1185	1209	8.22e-2	SMART
ZnF_U1	1239	1273	3.73e0	SMART
ZnF_C2H2	1242	1266	6.67e-2	SMART
low complexity region	1277	1304	N/A	INTRINSIC
low complexity region	1314	1326	N/A	INTRINSIC
low complexity region	1332	1346	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
low complexity region	1379	1400	N/A	INTRINSIC
low complexity region	1457	1465	N/A	INTRINSIC
ZnF_C2H2	1474	1497	5.34e0	SMART
low complexity region	1522	1531	N/A	INTRINSIC
low complexity region	1542	1554	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
HOX	1589	1651	1.97e-16	SMART
low complexity region	1656	1665	N/A	INTRINSIC
coiled coil region	1693	1723	N/A	INTRINSIC
ZnF_C2H2	1761	1783	2.53e-2	SMART
low complexity region	1837	1847	N/A	INTRINSIC
HOX	1851	1913	2.34e-18	SMART
low complexity region	1984	1995	N/A	INTRINSIC
low complexity region	2001	2051	N/A	INTRINSIC
HOX	2058	2120	1.52e-17	SMART
ZnF_U1	2136	2170	1.09e1	SMART
ZnF_C2H2	2139	2163	5.4e1	SMART
low complexity region	2328	2354	N/A	INTRINSIC
low complexity region	2385	2426	N/A	INTRINSIC
ZnF_U1	2482	2516	8.31e-1	SMART
ZnF_C2H2	2485	2509	9.46e0	SMART
low complexity region	2523	2538	N/A	INTRINSIC
low complexity region	2553	2562	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010K14Rik	A	T	11: 70,237,557	H30Q	probably damaging	Het
1700012P22Rik	T	A	4: 144,419,762	H107L	probably damaging	Het
A930009A15Rik	G	A	10: 115,581,989		probably null	Het
Abca7	T	C	10: 80,011,833	L1779P	probably damaging	Het
Aff1	G	A	5: 103,849,459	V1140I	possibly damaging	Het
Ano2	C	T	6: 125,712,419	A169V	probably damaging	Het
Atat1	T	C	17: 35,909,107	Y101C	possibly damaging	Het
Atp6v1c1	T	C	15: 38,683,011		probably null	Het
Atp7b	T	G	8: 22,011,506	K912T	probably damaging	Het
Ceacam14	T	C	7: 17,814,321	V112A	possibly damaging	Het
Cobll1	T	C	2: 65,095,857	N1119S	probably benign	Het
Csmd1	G	T	8: 15,918,331	Q3099K	possibly damaging	Het
Cyp3a25	A	G	5: 145,984,981	V381A	possibly damaging	Het
Dctn1	C	T	6: 83,195,069	R948*	probably null	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Esrp1	A	G	4: 11,384,449	V78A	probably damaging	Het
Evc2	A	G	5: 37,386,856	T650A	possibly damaging	Het
Exoc6b	T	A	6: 84,989,409	K194N	possibly damaging	Het
Fer1l6	G	A	15: 58,662,732	W1809*	probably null	Het
Frmd4a	T	A	2: 4,591,936	L156*	probably null	Het
Gk5	A	T	9: 96,153,210		probably null	Het
Gm3573	A	G	14: 42,189,750	F8L	probably benign	Het
Gm906	T	C	13: 50,250,260	E2G	possibly damaging	Het
Gm9767	G	A	10: 26,078,940	C130Y	unknown	Het
Grip2	T	C	6: 91,788,412	T30A	probably benign	Het
Gskip	C	A	12: 105,698,897	A65E	possibly damaging	Het
Gtf2e2	A	G	8: 33,776,465	R259G	probably benign	Het
Gucy1b2	T	A	14: 62,419,177	I244F	probably damaging	Het
Gxylt2	G	T	6: 100,798,190	V357L	possibly damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igdcc4	C	T	9: 65,133,758	P1024S	possibly damaging	Het
Ino80	A	T	2: 119,382,269		probably null	Het
Knl1	T	C	2: 119,095,133	F1881S	possibly damaging	Het
Mbd6	T	C	10: 127,285,230	E518G	unknown	Het
Mlh1	A	G	9: 111,229,890	S689P	probably damaging	Het
Mmrn2	T	C	14: 34,398,940	I589T	possibly damaging	Het
Mtmr12	C	T	15: 12,257,708	Q291*	probably null	Het
Mup8	T	A	4: 60,222,035	I33F	probably benign	Het
Mylk	C	T	16: 34,894,814	P504L	probably benign	Het
Ntrk3	C	T	7: 78,250,873	A573T	probably benign	Het
Obscn	G	T	11: 58,998,265	S7560R	unknown	Het
Olfr24	A	G	9: 18,754,882	F251S	possibly damaging	Het
Olfr617	A	C	7: 103,584,930	T303P	probably damaging	Het
Pde1c	T	C	6: 56,150,628	T391A	probably damaging	Het
Pla2g4d	T	A	2: 120,288,976	H19L	probably benign	Het
Plce1	C	A	19: 38,524,752	A165E	probably benign	Het
Polr1a	T	C	6: 71,913,021	S75P	probably benign	Het
Psg21	T	C	7: 18,654,783	E128G	probably benign	Het
Radil	A	T	5: 142,494,795	M635K	probably damaging	Het
Radil	A	G	5: 142,506,613	I420T	probably damaging	Het
Rnase11	G	A	14: 51,049,572	T175I	probably damaging	Het
Robo1	C	T	16: 72,563,738	P13S		Het
Slc18a2	C	A	19: 59,284,358	A364D	probably benign	Het
Snph	C	T	2: 151,594,586	D141N	probably damaging	Het
Snrnp70	T	C	7: 45,392,264	K70R	possibly damaging	Het
Snx33	T	C	9: 56,926,713	D24G	probably benign	Het
Spag6	T	A	2: 18,731,962	D165E	possibly damaging	Het
Spata31	T	G	13: 64,921,592	L518R	probably damaging	Het
Sspo	G	A	6: 48,489,727	V4059M	probably damaging	Het
St6galnac2	T	C	11: 116,679,979	Y261C	probably damaging	Het
Stoml1	A	G	9: 58,256,658	R87G	probably damaging	Het
Suv39h2	T	C	2: 3,474,829	T40A	unknown	Het
Terb2	G	T	2: 122,186,475	G26W	probably damaging	Het
Tmem62	T	C	2: 120,996,440	I406T	probably benign	Het
Tnfrsf11a	G	A	1: 105,844,732	V582I	probably benign	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Unc13c	T	C	9: 73,669,535	D1480G	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn1r48	C	A	6: 90,035,980	V288L	probably benign	Het
Vmn2r13	A	G	5: 109,173,640	V397A	probably damaging	Het
Vmn2r98	A	G	17: 19,067,308	N468D	possibly damaging	Het
Zswim5	T	A	4: 116,986,742	D992E	possibly damaging	Het

Other mutations in Zfhx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Zfhx2	APN	14	55066565	missense	possibly damaging	0.93
IGL00164:Zfhx2	APN	14	55065026	missense	possibly damaging	0.73
IGL00235:Zfhx2	APN	14	55063257	missense	probably benign	0.11
IGL00925:Zfhx2	APN	14	55073061	missense	probably benign	0.06
IGL01025:Zfhx2	APN	14	55064260	missense	probably damaging	1.00
IGL01061:Zfhx2	APN	14	55073882	missense	possibly damaging	0.96
IGL01486:Zfhx2	APN	14	55067090	missense	probably damaging	1.00
IGL01875:Zfhx2	APN	14	55063915	missense	unknown
IGL01990:Zfhx2	APN	14	55073590	missense	probably damaging	0.99
IGL02097:Zfhx2	APN	14	55062894	missense	probably damaging	1.00
IGL02269:Zfhx2	APN	14	55071936	missense	probably benign	0.00
IGL02488:Zfhx2	APN	14	55065103	missense	possibly damaging	0.72
IGL02624:Zfhx2	APN	14	55066628	missense	probably benign	0.06
IGL03087:Zfhx2	APN	14	55072845	missense	possibly damaging	0.85
G1patch:Zfhx2	UTSW	14	55064082	nonsense	probably null
PIT4403001:Zfhx2	UTSW	14	55074980	missense	probably benign
R0148:Zfhx2	UTSW	14	55072897	missense	possibly damaging	0.86
R0323:Zfhx2	UTSW	14	55065979	missense	possibly damaging	0.73
R0328:Zfhx2	UTSW	14	55071988	missense	probably benign
R0348:Zfhx2	UTSW	14	55063508	missense	probably damaging	0.99
R0442:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R0533:Zfhx2	UTSW	14	55064090	missense	probably benign	0.23
R0561:Zfhx2	UTSW	14	55065889	missense	probably benign	0.01
R0627:Zfhx2	UTSW	14	55065327	missense	probably benign
R0659:Zfhx2	UTSW	14	55073801	missense	possibly damaging	0.73
R0675:Zfhx2	UTSW	14	55063163	missense	probably damaging	0.99
R1301:Zfhx2	UTSW	14	55063397	missense	probably benign	0.32
R1563:Zfhx2	UTSW	14	55065088	missense	probably benign	0.33
R1607:Zfhx2	UTSW	14	55062985	missense	probably damaging	1.00
R1694:Zfhx2	UTSW	14	55073944	missense	possibly damaging	0.91
R1710:Zfhx2	UTSW	14	55065998	missense	possibly damaging	0.70
R1773:Zfhx2	UTSW	14	55072891	missense	possibly damaging	0.53
R1879:Zfhx2	UTSW	14	55065617	missense	probably benign	0.32
R1879:Zfhx2	UTSW	14	55072749	missense	possibly damaging	0.96
R1933:Zfhx2	UTSW	14	55075238	start gained	probably benign
R1944:Zfhx2	UTSW	14	55074732	missense	probably benign	0.18
R2888:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2889:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2915:Zfhx2	UTSW	14	55064557	missense	probably damaging	0.98
R3971:Zfhx2	UTSW	14	55074475	missense	probably benign	0.33
R4082:Zfhx2	UTSW	14	55065205	missense	probably benign
R4134:Zfhx2	UTSW	14	55065143	missense	possibly damaging	0.93
R4231:Zfhx2	UTSW	14	55073534	missense	possibly damaging	0.73
R4675:Zfhx2	UTSW	14	55067221	missense	probably benign	0.03
R4764:Zfhx2	UTSW	14	55066915	missense	possibly damaging	0.96
R4866:Zfhx2	UTSW	14	55065536	missense	possibly damaging	0.73
R4940:Zfhx2	UTSW	14	55066434	missense	possibly damaging	0.53
R5125:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5178:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5554:Zfhx2	UTSW	14	55064317	missense	probably damaging	1.00
R5689:Zfhx2	UTSW	14	55073903	missense	possibly damaging	0.53
R5768:Zfhx2	UTSW	14	55074365	missense	probably benign
R5792:Zfhx2	UTSW	14	55066846	missense	possibly damaging	0.72
R5834:Zfhx2	UTSW	14	55073330	nonsense	probably null
R5895:Zfhx2	UTSW	14	55065891	missense	probably benign
R5999:Zfhx2	UTSW	14	55074005	missense	probably benign
R6025:Zfhx2	UTSW	14	55065208	missense	probably benign	0.00
R6106:Zfhx2	UTSW	14	55068310	critical splice acceptor site	probably null
R6135:Zfhx2	UTSW	14	55074196	missense	possibly damaging	0.85
R6186:Zfhx2	UTSW	14	55063160	missense	probably damaging	0.99
R6379:Zfhx2	UTSW	14	55074338	missense	probably benign
R6725:Zfhx2	UTSW	14	55064082	nonsense	probably null
R7089:Zfhx2	UTSW	14	55065772	missense	probably benign	0.33
R7383:Zfhx2	UTSW	14	55068253	missense	probably benign	0.00
R7470:Zfhx2	UTSW	14	55066750	missense	possibly damaging	0.52
R7606:Zfhx2	UTSW	14	55066663	missense	probably benign	0.12
R7698:Zfhx2	UTSW	14	55062849	missense	probably benign	0.00
R7730:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R8142:Zfhx2	UTSW	14	55073438	missense	possibly damaging	0.86
R8188:Zfhx2	UTSW	14	55064441	missense	probably benign	0.18
R8212:Zfhx2	UTSW	14	55072916	missense	possibly damaging	0.70
R8264:Zfhx2	UTSW	14	55065512	missense	possibly damaging	0.53
R8331:Zfhx2	UTSW	14	55071987	missense	probably benign	0.00
R8369:Zfhx2	UTSW	14	55066744	missense	probably benign	0.05
R8371:Zfhx2	UTSW	14	55064092	missense	probably damaging	0.99
R8383:Zfhx2	UTSW	14	55074071	missense	possibly damaging	0.73
R8415:Zfhx2	UTSW	14	55070622	missense	probably benign
R8441:Zfhx2	UTSW	14	55066528	missense	possibly damaging	0.96
R8466:Zfhx2	UTSW	14	55072896	missense	possibly damaging	0.53
R8504:Zfhx2	UTSW	14	55065786	missense	probably benign	0.00
R8708:Zfhx2	UTSW	14	55075052	missense	probably benign
R8804:Zfhx2	UTSW	14	55074734	missense	probably benign	0.18
R8913:Zfhx2	UTSW	14	55072086	missense	probably benign	0.02
R8952:Zfhx2	UTSW	14	55072750	missense	possibly damaging	0.86
R9057:Zfhx2	UTSW	14	55072570	missense	possibly damaging	0.53
R9060:Zfhx2	UTSW	14	55074346	missense	probably benign	0.00
R9197:Zfhx2	UTSW	14	55074722	nonsense	probably null
R9622:Zfhx2	UTSW	14	55066026	missense	probably benign	0.18
R9623:Zfhx2	UTSW	14	55064734	missense	probably damaging	0.98
R9775:Zfhx2	UTSW	14	55067105	missense	probably benign	0.01
R9780:Zfhx2	UTSW	14	55075037	missense	probably benign	0.02
X0065:Zfhx2	UTSW	14	55066960	missense	probably benign	0.33
Z1088:Zfhx2	UTSW	14	55074180	missense	possibly damaging	0.73
Z1177:Zfhx2	UTSW	14	55065920	missense	probably benign	0.40
Z1177:Zfhx2	UTSW	14	55066982	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CATGAGTCTTGAGGATGAGCATG -3'
(R):5'- AACAACAGCTGCTTCTTCCC -3'

Sequencing Primer
(F):5'- CATGTTGGAGAAGAGTTTCCCAC -3'
(R):5'- TCTACCTCCATGACCTCAAGG -3'

Posted On

2019-10-24