Incidental Mutation 'R7607:Fer1l6'
ID588401
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7607 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 58662732 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 1809 (W1809*)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect probably null
Transcript: ENSMUST00000161028
AA Change: W1809*
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: W1809*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atat1 T C 17: 35,909,107 Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTCTGTTGCTCTCAGGG -3'
(R):5'- TCGCAGCACATGATCTTAGAGG -3'

Sequencing Primer
(F):5'- CTGTTGCTCTCAGGGGAATATTC -3'
(R):5'- TCTTAGAGGGCCCTGTATAGAAC -3'
Posted On2019-10-24