Incidental Mutation 'R7607:Robo1'
ID 588403
Institutional Source Beutler Lab
Gene Symbol Robo1
Ensembl Gene ENSMUSG00000022883
Gene Name roundabout guidance receptor 1
Synonyms DUTT1
MMRRC Submission 045677-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 72105194-72842983 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72360626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 13 (P13S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000231580]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000231580
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,128,383 (GRCm39) H30Q probably damaging Het
A930009A15Rik G A 10: 115,417,894 (GRCm39) probably null Het
Abca7 T C 10: 79,847,667 (GRCm39) L1779P probably damaging Het
Aff1 G A 5: 103,997,325 (GRCm39) V1140I possibly damaging Het
Ano2 C T 6: 125,689,382 (GRCm39) A169V probably damaging Het
Atat1 T C 17: 36,219,999 (GRCm39) Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,255 (GRCm39) probably null Het
Atp7b T G 8: 22,501,522 (GRCm39) K912T probably damaging Het
Ceacam14 T C 7: 17,548,246 (GRCm39) V112A possibly damaging Het
Cfap107 T A 4: 144,146,332 (GRCm39) H107L probably damaging Het
Cobll1 T C 2: 64,926,201 (GRCm39) N1119S probably benign Het
Csmd1 G T 8: 15,968,331 (GRCm39) Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,921,791 (GRCm39) V381A possibly damaging Het
Dctn1 C T 6: 83,172,051 (GRCm39) R948* probably null Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Esrp1 A G 4: 11,384,449 (GRCm39) V78A probably damaging Het
Evc2 A G 5: 37,544,200 (GRCm39) T650A possibly damaging Het
Exoc6b T A 6: 84,966,391 (GRCm39) K194N possibly damaging Het
Fer1l6 G A 15: 58,534,581 (GRCm39) W1809* probably null Het
Frmd4a T A 2: 4,596,747 (GRCm39) L156* probably null Het
Gk5 A T 9: 96,035,263 (GRCm39) probably null Het
Gm3573 A G 14: 42,011,707 (GRCm39) F8L probably benign Het
Gm9767 G A 10: 25,954,838 (GRCm39) C130Y unknown Het
Grip2 T C 6: 91,765,393 (GRCm39) T30A probably benign Het
Gskip C A 12: 105,665,156 (GRCm39) A65E possibly damaging Het
Gtf2e2 A G 8: 34,266,493 (GRCm39) R259G probably benign Het
Gucy1b2 T A 14: 62,656,626 (GRCm39) I244F probably damaging Het
Gxylt2 G T 6: 100,775,151 (GRCm39) V357L possibly damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igdcc4 C T 9: 65,041,040 (GRCm39) P1024S possibly damaging Het
Ino80 A T 2: 119,212,750 (GRCm39) probably null Het
Knl1 T C 2: 118,925,614 (GRCm39) F1881S possibly damaging Het
Mbd6 T C 10: 127,121,099 (GRCm39) E518G unknown Het
Mlh1 A G 9: 111,058,958 (GRCm39) S689P probably damaging Het
Mmrn2 T C 14: 34,120,897 (GRCm39) I589T possibly damaging Het
Mtmr12 C T 15: 12,257,794 (GRCm39) Q291* probably null Het
Mup8 T A 4: 60,222,035 (GRCm39) I33F probably benign Het
Mylk C T 16: 34,715,184 (GRCm39) P504L probably benign Het
Ntrk3 C T 7: 77,900,621 (GRCm39) A573T probably benign Het
Obscn G T 11: 58,889,091 (GRCm39) S7560R unknown Het
Or1m1 A G 9: 18,666,178 (GRCm39) F251S possibly damaging Het
Or52z12 A C 7: 103,234,137 (GRCm39) T303P probably damaging Het
Pde1c T C 6: 56,127,613 (GRCm39) T391A probably damaging Het
Pla2g4d T A 2: 120,119,457 (GRCm39) H19L probably benign Het
Plce1 C A 19: 38,513,196 (GRCm39) A165E probably benign Het
Polr1a T C 6: 71,890,005 (GRCm39) S75P probably benign Het
Psg21 T C 7: 18,388,708 (GRCm39) E128G probably benign Het
Radil A G 5: 142,492,368 (GRCm39) I420T probably damaging Het
Radil A T 5: 142,480,550 (GRCm39) M635K probably damaging Het
Rnase11 G A 14: 51,287,029 (GRCm39) T175I probably damaging Het
Slc18a2 C A 19: 59,272,790 (GRCm39) A364D probably benign Het
Snph C T 2: 151,436,506 (GRCm39) D141N probably damaging Het
Snrnp70 T C 7: 45,041,688 (GRCm39) K70R possibly damaging Het
Snx33 T C 9: 56,833,997 (GRCm39) D24G probably benign Het
Spag6 T A 2: 18,736,773 (GRCm39) D165E possibly damaging Het
Spata31 T G 13: 65,069,406 (GRCm39) L518R probably damaging Het
Spata31e3 T C 13: 50,404,296 (GRCm39) E2G possibly damaging Het
Sspo G A 6: 48,466,661 (GRCm39) V4059M probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stoml1 A G 9: 58,163,941 (GRCm39) R87G probably damaging Het
Suv39h2 T C 2: 3,475,866 (GRCm39) T40A unknown Het
Terb2 G T 2: 122,016,956 (GRCm39) G26W probably damaging Het
Tmem62 T C 2: 120,826,921 (GRCm39) I406T probably benign Het
Tnfrsf11a G A 1: 105,772,458 (GRCm39) V582I probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Unc13c T C 9: 73,576,817 (GRCm39) D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r48 C A 6: 90,012,962 (GRCm39) V288L probably benign Het
Vmn2r13 A G 5: 109,321,506 (GRCm39) V397A probably damaging Het
Vmn2r98 A G 17: 19,287,570 (GRCm39) N468D possibly damaging Het
Zfhx2 G T 14: 55,303,688 (GRCm39) T1432K possibly damaging Het
Zswim5 T A 4: 116,843,939 (GRCm39) D992E possibly damaging Het
Other mutations in Robo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Robo1 APN 16 72,801,553 (GRCm39) missense probably benign 0.00
IGL01937:Robo1 APN 16 72,759,114 (GRCm39) missense probably damaging 1.00
IGL01945:Robo1 APN 16 72,759,114 (GRCm39) missense probably damaging 1.00
IGL02151:Robo1 APN 16 72,786,504 (GRCm39) missense probably benign 0.00
IGL02232:Robo1 APN 16 72,768,872 (GRCm39) missense possibly damaging 0.59
IGL02282:Robo1 APN 16 72,539,026 (GRCm39) missense probably damaging 1.00
IGL02590:Robo1 APN 16 72,840,020 (GRCm39) missense probably benign 0.06
IGL02874:Robo1 APN 16 72,809,806 (GRCm39) missense probably damaging 0.96
IGL02974:Robo1 APN 16 72,803,750 (GRCm39) missense probably benign 0.09
IGL03233:Robo1 APN 16 72,767,081 (GRCm39) missense probably damaging 0.99
PIT4378001:Robo1 UTSW 16 72,801,423 (GRCm39) missense probably damaging 1.00
R0079:Robo1 UTSW 16 72,730,230 (GRCm39) splice site probably benign
R0254:Robo1 UTSW 16 72,461,058 (GRCm39) missense probably benign 0.00
R0366:Robo1 UTSW 16 72,539,133 (GRCm39) missense possibly damaging 0.52
R0410:Robo1 UTSW 16 72,768,872 (GRCm39) missense possibly damaging 0.59
R0511:Robo1 UTSW 16 72,810,013 (GRCm39) critical splice donor site probably null
R0563:Robo1 UTSW 16 72,769,174 (GRCm39) missense probably benign 0.01
R0637:Robo1 UTSW 16 72,798,839 (GRCm39) missense probably benign 0.29
R1239:Robo1 UTSW 16 72,821,430 (GRCm39) splice site probably null
R1773:Robo1 UTSW 16 72,801,399 (GRCm39) missense probably benign 0.00
R1777:Robo1 UTSW 16 72,801,555 (GRCm39) missense probably benign
R1901:Robo1 UTSW 16 72,757,092 (GRCm39) missense probably null 1.00
R1902:Robo1 UTSW 16 72,757,092 (GRCm39) missense probably null 1.00
R1903:Robo1 UTSW 16 72,757,092 (GRCm39) missense probably null 1.00
R1996:Robo1 UTSW 16 72,767,067 (GRCm39) missense probably benign 0.40
R2040:Robo1 UTSW 16 72,730,630 (GRCm39) missense probably damaging 1.00
R2266:Robo1 UTSW 16 72,775,660 (GRCm39) missense probably benign
R2269:Robo1 UTSW 16 72,775,660 (GRCm39) missense probably benign
R2433:Robo1 UTSW 16 72,767,127 (GRCm39) missense probably benign 0.01
R3084:Robo1 UTSW 16 72,801,625 (GRCm39) missense probably benign 0.02
R3085:Robo1 UTSW 16 72,798,898 (GRCm39) missense possibly damaging 0.81
R3150:Robo1 UTSW 16 72,767,157 (GRCm39) missense possibly damaging 0.57
R3418:Robo1 UTSW 16 72,832,805 (GRCm39) missense probably benign 0.00
R3610:Robo1 UTSW 16 72,780,658 (GRCm39) missense probably benign 0.00
R3940:Robo1 UTSW 16 72,806,631 (GRCm39) missense probably benign
R3953:Robo1 UTSW 16 72,821,226 (GRCm39) missense probably damaging 1.00
R4692:Robo1 UTSW 16 72,757,090 (GRCm39) missense probably damaging 1.00
R4726:Robo1 UTSW 16 72,768,931 (GRCm39) missense probably damaging 1.00
R4814:Robo1 UTSW 16 72,768,923 (GRCm39) missense probably benign 0.11
R4884:Robo1 UTSW 16 72,701,639 (GRCm39) missense probably damaging 1.00
R4992:Robo1 UTSW 16 72,776,756 (GRCm39) missense probably damaging 0.98
R5150:Robo1 UTSW 16 72,769,192 (GRCm39) missense possibly damaging 0.79
R5183:Robo1 UTSW 16 72,539,038 (GRCm39) missense probably benign 0.03
R5360:Robo1 UTSW 16 72,732,665 (GRCm39) missense probably damaging 0.96
R5629:Robo1 UTSW 16 72,780,598 (GRCm39) missense probably benign 0.33
R5804:Robo1 UTSW 16 72,840,077 (GRCm39) critical splice donor site probably null
R6107:Robo1 UTSW 16 72,780,717 (GRCm39) missense probably benign 0.00
R6127:Robo1 UTSW 16 72,809,956 (GRCm39) missense probably benign
R6128:Robo1 UTSW 16 72,809,956 (GRCm39) missense probably benign
R6129:Robo1 UTSW 16 72,809,956 (GRCm39) missense probably benign
R6191:Robo1 UTSW 16 72,730,696 (GRCm39) missense probably benign 0.00
R6357:Robo1 UTSW 16 72,767,190 (GRCm39) missense probably benign 0.00
R6408:Robo1 UTSW 16 72,768,934 (GRCm39) missense probably benign 0.00
R6516:Robo1 UTSW 16 72,821,241 (GRCm39) missense probably benign 0.14
R6600:Robo1 UTSW 16 72,786,543 (GRCm39) missense probably damaging 1.00
R6802:Robo1 UTSW 16 72,730,201 (GRCm39) missense probably benign 0.17
R7105:Robo1 UTSW 16 72,539,049 (GRCm39) missense probably damaging 1.00
R7189:Robo1 UTSW 16 72,757,039 (GRCm39) nonsense probably null
R7290:Robo1 UTSW 16 72,801,408 (GRCm39) missense probably benign 0.03
R7296:Robo1 UTSW 16 72,786,519 (GRCm39) nonsense probably null
R7576:Robo1 UTSW 16 72,767,069 (GRCm39) missense probably damaging 0.99
R7605:Robo1 UTSW 16 72,821,189 (GRCm39) missense probably benign 0.14
R7634:Robo1 UTSW 16 72,839,866 (GRCm39) splice site probably null
R7636:Robo1 UTSW 16 72,360,615 (GRCm39) missense
R7857:Robo1 UTSW 16 72,767,099 (GRCm39) missense probably damaging 1.00
R7966:Robo1 UTSW 16 72,780,760 (GRCm39) missense possibly damaging 0.62
R7997:Robo1 UTSW 16 72,701,581 (GRCm39) missense probably damaging 1.00
R8101:Robo1 UTSW 16 72,775,469 (GRCm39) missense probably benign 0.03
R8191:Robo1 UTSW 16 72,730,142 (GRCm39) missense probably damaging 1.00
R8218:Robo1 UTSW 16 72,786,678 (GRCm39) missense possibly damaging 0.91
R8228:Robo1 UTSW 16 72,809,768 (GRCm39) missense probably benign 0.30
R8292:Robo1 UTSW 16 72,769,420 (GRCm39) missense possibly damaging 0.61
R8298:Robo1 UTSW 16 72,769,020 (GRCm39) intron probably benign
R8332:Robo1 UTSW 16 72,775,466 (GRCm39) missense probably damaging 1.00
R8402:Robo1 UTSW 16 72,821,385 (GRCm39) missense probably benign 0.16
R8492:Robo1 UTSW 16 72,809,911 (GRCm39) missense probably benign 0.06
R8730:Robo1 UTSW 16 72,786,495 (GRCm39) missense probably benign 0.08
R8774:Robo1 UTSW 16 72,832,719 (GRCm39) missense probably benign 0.00
R8774-TAIL:Robo1 UTSW 16 72,832,719 (GRCm39) missense probably benign 0.00
R8776:Robo1 UTSW 16 72,821,141 (GRCm39) nonsense probably null
R8776-TAIL:Robo1 UTSW 16 72,821,141 (GRCm39) nonsense probably null
R8905:Robo1 UTSW 16 72,539,173 (GRCm39) missense probably damaging 1.00
R8913:Robo1 UTSW 16 72,701,622 (GRCm39) missense probably damaging 1.00
R9003:Robo1 UTSW 16 72,539,002 (GRCm39) splice site probably benign
R9246:Robo1 UTSW 16 72,769,178 (GRCm39) missense probably benign
R9451:Robo1 UTSW 16 72,803,718 (GRCm39) missense probably benign 0.10
R9509:Robo1 UTSW 16 72,759,167 (GRCm39) missense probably damaging 0.96
R9652:Robo1 UTSW 16 72,821,330 (GRCm39) missense possibly damaging 0.95
R9653:Robo1 UTSW 16 72,821,330 (GRCm39) missense possibly damaging 0.95
R9749:Robo1 UTSW 16 72,105,257 (GRCm39) start gained probably benign
Z1176:Robo1 UTSW 16 72,774,688 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAAGGAAGACGTGTGCTGTG -3'
(R):5'- TTACAGTTGCAGTTAAGACGCTG -3'

Sequencing Primer
(F):5'- AAGACGTGTGCTGTGTGTTGTC -3'
(R):5'- TGAGGACTAGAAGCTGTGGC -3'
Posted On 2019-10-24