Incidental Mutation 'R7607:Atat1'
ID588407
Institutional Source Beutler Lab
Gene Symbol Atat1
Ensembl Gene ENSMUSG00000024426
Gene Namealpha tubulin acetyltransferase 1
Synonyms2610110G12Rik, 0610011P08Rik, 3110080J08Rik, 2610008K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7607 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35897595-35910075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35909107 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 101 (Y101C)
Ref Sequence ENSEMBL: ENSMUSP00000056383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025305] [ENSMUST00000056034] [ENSMUST00000061052] [ENSMUST00000077494] [ENSMUST00000113782] [ENSMUST00000141132] [ENSMUST00000141662] [ENSMUST00000149277] [ENSMUST00000174807]
Predicted Effect probably benign
Transcript: ENSMUST00000025305
SMART Domains Protein: ENSMUSP00000025305
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 109 161 8.1e-18 PFAM
low complexity region 196 207 N/A INTRINSIC
low complexity region 208 217 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056034
AA Change: Y101C

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053853
Gene: ENSMUSG00000024426
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061052
AA Change: Y101C

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056383
Gene: ENSMUSG00000024426
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 74 191 1.5e-53 PFAM
Pfam:Acetyltransf_1 88 157 6.8e-5 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077494
AA Change: Y101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076703
Gene: ENSMUSG00000024426
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113782
SMART Domains Protein: ENSMUSP00000109412
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 18 69 5.1e-16 PFAM
low complexity region 104 115 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 132 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126744
SMART Domains Protein: ENSMUSP00000122211
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
Pfam:Mec-17 1 83 2.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137182
Predicted Effect probably benign
Transcript: ENSMUST00000140292
SMART Domains Protein: ENSMUSP00000119039
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
PDB:4GS4|A 2 36 9e-13 PDB
low complexity region 50 67 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141132
AA Change: Y58C

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117824
Gene: ENSMUSG00000024426
AA Change: Y58C

DomainStartEndE-ValueType
Pfam:Mec-17 29 149 9.1e-59 PFAM
low complexity region 166 177 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141662
AA Change: Y101C

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115004
Gene: ENSMUSG00000024426
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.7e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149277
AA Change: Y101C

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122715
Gene: ENSMUSG00000024426
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172642
Predicted Effect probably benign
Transcript: ENSMUST00000174349
Predicted Effect probably benign
Transcript: ENSMUST00000174807
SMART Domains Protein: ENSMUSP00000133584
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
SCOP:d1fjgr_ 91 128 1e-8 SMART
low complexity region 130 141 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired alpha tubulin acetylation and abnormal dentate gyrus morphology. Mice homozygous for a different knock-out allele exhibit reduced male fertility associated with teratozoospermia, oligozoospermia andasthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,237,557 H30Q probably damaging Het
1700012P22Rik T A 4: 144,419,762 H107L probably damaging Het
A930009A15Rik G A 10: 115,581,989 probably null Het
Abca7 T C 10: 80,011,833 L1779P probably damaging Het
Aff1 G A 5: 103,849,459 V1140I possibly damaging Het
Ano2 C T 6: 125,712,419 A169V probably damaging Het
Atp6v1c1 T C 15: 38,683,011 probably null Het
Atp7b T G 8: 22,011,506 K912T probably damaging Het
Ceacam14 T C 7: 17,814,321 V112A possibly damaging Het
Cobll1 T C 2: 65,095,857 N1119S probably benign Het
Csmd1 G T 8: 15,918,331 Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,984,981 V381A possibly damaging Het
Dctn1 C T 6: 83,195,069 R948* probably null Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Esrp1 A G 4: 11,384,449 V78A probably damaging Het
Evc2 A G 5: 37,386,856 T650A possibly damaging Het
Exoc6b T A 6: 84,989,409 K194N possibly damaging Het
Fer1l6 G A 15: 58,662,732 W1809* probably null Het
Frmd4a T A 2: 4,591,936 L156* probably null Het
Gk5 A T 9: 96,153,210 probably null Het
Gm3573 A G 14: 42,189,750 F8L probably benign Het
Gm906 T C 13: 50,250,260 E2G possibly damaging Het
Gm9767 G A 10: 26,078,940 C130Y unknown Het
Grip2 T C 6: 91,788,412 T30A probably benign Het
Gskip C A 12: 105,698,897 A65E possibly damaging Het
Gtf2e2 A G 8: 33,776,465 R259G probably benign Het
Gucy1b2 T A 14: 62,419,177 I244F probably damaging Het
Gxylt2 G T 6: 100,798,190 V357L possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igdcc4 C T 9: 65,133,758 P1024S possibly damaging Het
Ino80 A T 2: 119,382,269 probably null Het
Knl1 T C 2: 119,095,133 F1881S possibly damaging Het
Mbd6 T C 10: 127,285,230 E518G unknown Het
Mlh1 A G 9: 111,229,890 S689P probably damaging Het
Mmrn2 T C 14: 34,398,940 I589T possibly damaging Het
Mtmr12 C T 15: 12,257,708 Q291* probably null Het
Mup8 T A 4: 60,222,035 I33F probably benign Het
Mylk C T 16: 34,894,814 P504L probably benign Het
Ntrk3 C T 7: 78,250,873 A573T probably benign Het
Obscn G T 11: 58,998,265 S7560R unknown Het
Olfr24 A G 9: 18,754,882 F251S possibly damaging Het
Olfr617 A C 7: 103,584,930 T303P probably damaging Het
Pde1c T C 6: 56,150,628 T391A probably damaging Het
Pla2g4d T A 2: 120,288,976 H19L probably benign Het
Plce1 C A 19: 38,524,752 A165E probably benign Het
Polr1a T C 6: 71,913,021 S75P probably benign Het
Psg21 T C 7: 18,654,783 E128G probably benign Het
Radil A T 5: 142,494,795 M635K probably damaging Het
Radil A G 5: 142,506,613 I420T probably damaging Het
Rnase11 G A 14: 51,049,572 T175I probably damaging Het
Robo1 C T 16: 72,563,738 P13S Het
Slc18a2 C A 19: 59,284,358 A364D probably benign Het
Snph C T 2: 151,594,586 D141N probably damaging Het
Snrnp70 T C 7: 45,392,264 K70R possibly damaging Het
Snx33 T C 9: 56,926,713 D24G probably benign Het
Spag6 T A 2: 18,731,962 D165E possibly damaging Het
Spata31 T G 13: 64,921,592 L518R probably damaging Het
Sspo G A 6: 48,489,727 V4059M probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stoml1 A G 9: 58,256,658 R87G probably damaging Het
Suv39h2 T C 2: 3,474,829 T40A unknown Het
Terb2 G T 2: 122,186,475 G26W probably damaging Het
Tmem62 T C 2: 120,996,440 I406T probably benign Het
Tnfrsf11a G A 1: 105,844,732 V582I probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Unc13c T C 9: 73,669,535 D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r48 C A 6: 90,035,980 V288L probably benign Het
Vmn2r13 A G 5: 109,173,640 V397A probably damaging Het
Vmn2r98 A G 17: 19,067,308 N468D possibly damaging Het
Zfhx2 G T 14: 55,066,231 T1432K possibly damaging Het
Zswim5 T A 4: 116,986,742 D992E possibly damaging Het
Other mutations in Atat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Atat1 APN 17 35897883 missense probably benign 0.04
IGL01903:Atat1 APN 17 35897800 missense probably benign 0.00
IGL01958:Atat1 APN 17 35908843 unclassified probably benign
IGL02725:Atat1 APN 17 35909489 missense probably benign 0.01
IGL02729:Atat1 APN 17 35898391 missense probably benign 0.00
R0633:Atat1 UTSW 17 35901423 missense probably damaging 1.00
R1541:Atat1 UTSW 17 35904331 missense probably damaging 1.00
R1944:Atat1 UTSW 17 35909340 missense probably damaging 1.00
R2054:Atat1 UTSW 17 35901369 missense probably null 0.99
R2132:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R4967:Atat1 UTSW 17 35901575 missense probably damaging 1.00
R6062:Atat1 UTSW 17 35908564 missense probably damaging 1.00
R6347:Atat1 UTSW 17 35910029 missense probably damaging 1.00
R6380:Atat1 UTSW 17 35908957 splice site probably null
R7010:Atat1 UTSW 17 35908630 missense probably damaging 1.00
R7028:Atat1 UTSW 17 35910005 missense probably benign 0.01
R7230:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R7520:Atat1 UTSW 17 35897814 missense probably benign 0.36
R8104:Atat1 UTSW 17 35904116 missense probably benign 0.08
R8334:Atat1 UTSW 17 35909258 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAATGCAAAGGGGTTCTACCTC -3'
(R):5'- TCACCAGCGCTTTGAGGATG -3'

Sequencing Primer
(F):5'- CAAAGGGGTTCTACCTCATTGTGAG -3'
(R):5'- GGCACGTTATTTACATACTGAAGGAC -3'
Posted On2019-10-24