Incidental Mutation 'R7608:Abcb6'
ID588410
Institutional Source Beutler Lab
Gene Symbol Abcb6
Ensembl Gene ENSMUSG00000026198
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 6
Synonyms1200005B17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_023732.2; Ensembl: ENSMUST00000027396, ENSMUST00000161215

Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75171717-75180392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75177703 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 311 (F311S)
Ref Sequence ENSEMBL: ENSMUSP00000027396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027396] [ENSMUST00000040689] [ENSMUST00000161215] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
Predicted Effect probably benign
Transcript: ENSMUST00000027396
AA Change: F311S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: F311S

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040689
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161215
SMART Domains Protein: ENSMUSP00000124630
Gene: ENSMUSG00000026198

DomainStartEndE-ValueType
SCOP:d1jj7a_ 5 78 8e-23 SMART
Blast:AAA 23 71 9e-25 BLAST
PDB:3NHB|A 23 94 3e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188347
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189702
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189820
Meta Mutation Damage Score 0.3579 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Abcb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Abcb6 APN 1 75178002 missense probably damaging 0.96
1mM(1):Abcb6 UTSW 1 75172111 unclassified probably benign
R0035:Abcb6 UTSW 1 75175007 missense possibly damaging 0.74
R0699:Abcb6 UTSW 1 75171909 missense probably damaging 0.98
R1470:Abcb6 UTSW 1 75172679 unclassified probably benign
R1595:Abcb6 UTSW 1 75177300 unclassified probably null
R1912:Abcb6 UTSW 1 75179955 missense probably benign
R2078:Abcb6 UTSW 1 75172136 missense probably damaging 1.00
R3105:Abcb6 UTSW 1 75175043 unclassified probably benign
R4015:Abcb6 UTSW 1 75174491 unclassified probably null
R4604:Abcb6 UTSW 1 75179877 missense probably benign
R4633:Abcb6 UTSW 1 75177782 unclassified probably benign
R4748:Abcb6 UTSW 1 75177358 missense probably damaging 1.00
R5530:Abcb6 UTSW 1 75177912 unclassified probably benign
R5654:Abcb6 UTSW 1 75174835 unclassified probably null
R5841:Abcb6 UTSW 1 75174350 missense possibly damaging 0.88
R6275:Abcb6 UTSW 1 75172551 splice site probably null
R6527:Abcb6 UTSW 1 75177488 critical splice acceptor site probably null
R7188:Abcb6 UTSW 1 75174137 critical splice donor site probably null
R7278:Abcb6 UTSW 1 75174373 missense possibly damaging 0.88
R7451:Abcb6 UTSW 1 75172153 missense probably damaging 1.00
R7481:Abcb6 UTSW 1 75173604 missense probably damaging 1.00
R7640:Abcb6 UTSW 1 75174845 intron probably null
R7883:Abcb6 UTSW 1 75178016 missense possibly damaging 0.81
R7966:Abcb6 UTSW 1 75178016 missense possibly damaging 0.81
R8057:Abcb6 UTSW 1 75174358 missense probably damaging 0.99
R8058:Abcb6 UTSW 1 75180009 missense possibly damaging 0.79
X0009:Abcb6 UTSW 1 75174553 missense probably benign 0.35
Z1177:Abcb6 UTSW 1 75176125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCTCACAAAACCTGGGG -3'
(R):5'- CACTCAATGTGTTGGTCCCC -3'

Sequencing Primer
(F):5'- TCACAAAACCTGGGGAAGCC -3'
(R):5'- CCCATCTTCTATAGGGACATTGGTG -3'
Posted On2019-10-24