Incidental Mutation 'R7608:Scg2'
ID588411
Institutional Source Beutler Lab
Gene Symbol Scg2
Ensembl Gene ENSMUSG00000050711
Gene Namesecretogranin II
SynonymsSgII, Chgc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location79434669-79440120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79436181 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 275 (E275G)
Ref Sequence ENSEMBL: ENSMUSP00000139740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049972
AA Change: E275G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: E275G

DomainStartEndE-ValueType
Pfam:Granin 27 614 7.2e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185234
AA Change: E275G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711
AA Change: E275G

DomainStartEndE-ValueType
Pfam:Granin 27 319 1.4e-123 PFAM
Pfam:Granin 316 574 7.1e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Scg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Scg2 APN 1 79436821 missense probably benign 0.16
IGL02083:Scg2 APN 1 79436224 missense probably benign 0.00
IGL02316:Scg2 APN 1 79435681 missense probably damaging 1.00
IGL02338:Scg2 APN 1 79436493 missense possibly damaging 0.93
R0281:Scg2 UTSW 1 79435512 missense possibly damaging 0.95
R0384:Scg2 UTSW 1 79435549 missense probably benign 0.42
R0501:Scg2 UTSW 1 79435603 missense probably damaging 1.00
R0909:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R1773:Scg2 UTSW 1 79435635 missense probably benign 0.04
R2254:Scg2 UTSW 1 79436500 missense probably damaging 1.00
R4074:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4076:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4097:Scg2 UTSW 1 79435821 missense probably damaging 0.99
R4560:Scg2 UTSW 1 79435181 missense probably damaging 1.00
R4621:Scg2 UTSW 1 79436664 missense probably benign 0.08
R4876:Scg2 UTSW 1 79435919 missense probably damaging 1.00
R4944:Scg2 UTSW 1 79436476 nonsense probably null
R5829:Scg2 UTSW 1 79436920 missense probably damaging 1.00
R6158:Scg2 UTSW 1 79435400 missense probably damaging 1.00
R6248:Scg2 UTSW 1 79436306 missense probably benign 0.29
R6365:Scg2 UTSW 1 79435300 missense probably benign
R6459:Scg2 UTSW 1 79436290 missense probably damaging 1.00
R6676:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R6693:Scg2 UTSW 1 79436020 missense probably benign 0.01
R7259:Scg2 UTSW 1 79436985 missense probably benign
R7393:Scg2 UTSW 1 79435231 missense probably damaging 1.00
R7578:Scg2 UTSW 1 79436895 missense probably damaging 0.99
Z1176:Scg2 UTSW 1 79436789 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATTTGGCCCACTCTGTGAC -3'
(R):5'- GGAGTCTGTGTTCCAAGAGC -3'

Sequencing Primer
(F):5'- ACTCTGTGACCTCCCACTG -3'
(R):5'- CTTGGGAAACTGACAGGGCC -3'
Posted On2019-10-24