Incidental Mutation 'R7608:Olfr1252'
ID588416
Institutional Source Beutler Lab
Gene Symbol Olfr1252
Ensembl Gene ENSMUSG00000110819
Gene Nameolfactory receptor 1252
SynonymsMOR231-22_p, GA_x6K02T2Q125-51162884-51161940
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89719575-89725012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89721298 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 271 (V271A)
Ref Sequence ENSEMBL: ENSMUSP00000150304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186710] [ENSMUST00000213196] [ENSMUST00000216203]
Predicted Effect probably benign
Transcript: ENSMUST00000186710
AA Change: V271A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140045
Gene: ENSMUSG00000110819
AA Change: V271A

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.1e-28 PFAM
Pfam:7tm_4 137 278 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213196
AA Change: V271A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216203
AA Change: V271A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Olfr1252
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr1252 APN 2 89721526 missense probably damaging 1.00
PIT4151001:Olfr1252 UTSW 2 89721893 missense probably benign 0.42
R1838:Olfr1252 UTSW 2 89721709 missense probably damaging 0.99
R1866:Olfr1252 UTSW 2 89721206 missense probably benign 0.00
R3835:Olfr1252 UTSW 2 89721455 missense possibly damaging 0.75
R4577:Olfr1252 UTSW 2 89722043 missense possibly damaging 0.80
R4675:Olfr1252 UTSW 2 89721494 missense probably benign
R4799:Olfr1252 UTSW 2 89721362 missense probably benign 0.24
R4845:Olfr1252 UTSW 2 89721776 missense probably benign 0.05
R5076:Olfr1252 UTSW 2 89721401 missense probably damaging 1.00
R5160:Olfr1252 UTSW 2 89721419 missense probably damaging 0.99
R5384:Olfr1252 UTSW 2 89721305 missense possibly damaging 0.94
R5418:Olfr1252 UTSW 2 89721999 missense probably benign
R5763:Olfr1252 UTSW 2 89722028 missense probably benign 0.00
R6997:Olfr1252 UTSW 2 89721925 missense possibly damaging 0.71
R7013:Olfr1252 UTSW 2 89721386 missense probably benign 0.20
R7500:Olfr1252 UTSW 2 89721937 missense possibly damaging 0.90
R7671:Olfr1252 UTSW 2 89721259 missense probably damaging 1.00
R7781:Olfr1252 UTSW 2 89721535 missense probably benign 0.38
R7841:Olfr1252 UTSW 2 89721965 missense probably benign 0.06
R7924:Olfr1252 UTSW 2 89721965 missense probably benign 0.06
R7999:Olfr1252 UTSW 2 89722000 missense probably benign 0.06
X0064:Olfr1252 UTSW 2 89721356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTGAGGTTGAACTGCC -3'
(R):5'- AGCAATGTCTATAGTGGTCTTTGTC -3'

Sequencing Primer
(F):5'- CTGCCAAAATTTAATATTGGATGCC -3'
(R):5'- GTCTATAGTGGTCTTTGTCCTCCTC -3'
Posted On2019-10-24