Incidental Mutation 'R7608:Slc16a4'
ID588421
Institutional Source Beutler Lab
Gene Symbol Slc16a4
Ensembl Gene ENSMUSG00000027896
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107291230-107312115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107303127 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 371 (Y371F)
Ref Sequence ENSEMBL: ENSMUSP00000029502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029502] [ENSMUST00000106723]
Predicted Effect probably damaging
Transcript: ENSMUST00000029502
AA Change: Y371F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029502
Gene: ENSMUSG00000027896
AA Change: Y371F

DomainStartEndE-ValueType
Pfam:MFS_1 27 373 8.2e-26 PFAM
Pfam:MFS_1 305 499 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106723
AA Change: Y371F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102334
Gene: ENSMUSG00000027896
AA Change: Y371F

DomainStartEndE-ValueType
Pfam:MFS_1 27 375 2.1e-28 PFAM
Pfam:MFS_1 327 462 3.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Slc16a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc16a4 APN 3 107303100 missense possibly damaging 0.67
IGL01311:Slc16a4 APN 3 107292505 missense possibly damaging 0.83
IGL01509:Slc16a4 APN 3 107311434 critical splice acceptor site probably null
IGL01780:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02294:Slc16a4 APN 3 107301068 missense probably benign 0.00
IGL02350:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02357:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02792:Slc16a4 APN 3 107298877 missense probably benign
IGL02873:Slc16a4 APN 3 107300795 missense probably benign 0.00
IGL03001:Slc16a4 APN 3 107311542 missense possibly damaging 0.91
IGL03002:Slc16a4 APN 3 107300786 missense probably benign 0.07
R0370:Slc16a4 UTSW 3 107301097 missense possibly damaging 0.66
R0525:Slc16a4 UTSW 3 107297939 splice site probably benign
R1192:Slc16a4 UTSW 3 107298873 missense probably benign 0.07
R1458:Slc16a4 UTSW 3 107300932 missense probably benign 0.00
R1939:Slc16a4 UTSW 3 107301001 missense probably benign 0.00
R2061:Slc16a4 UTSW 3 107300711 missense probably benign 0.00
R2098:Slc16a4 UTSW 3 107300847 nonsense probably null
R2102:Slc16a4 UTSW 3 107304503 splice site probably null
R3411:Slc16a4 UTSW 3 107300872 missense probably benign
R4983:Slc16a4 UTSW 3 107300860 missense probably benign 0.00
R5394:Slc16a4 UTSW 3 107292442 missense probably benign
R5804:Slc16a4 UTSW 3 107298964 missense probably benign 0.04
R6077:Slc16a4 UTSW 3 107301065 missense possibly damaging 0.91
R6626:Slc16a4 UTSW 3 107301196 missense possibly damaging 0.95
R6693:Slc16a4 UTSW 3 107303064 missense probably damaging 1.00
R6811:Slc16a4 UTSW 3 107298917 missense probably benign 0.06
R6823:Slc16a4 UTSW 3 107311498 missense probably benign 0.02
R6982:Slc16a4 UTSW 3 107299273 missense probably benign 0.01
R7050:Slc16a4 UTSW 3 107300832 missense probably benign
R7103:Slc16a4 UTSW 3 107311471 missense probably damaging 1.00
R7623:Slc16a4 UTSW 3 107297981 missense possibly damaging 0.71
R8013:Slc16a4 UTSW 3 107311478 missense probably damaging 1.00
R8014:Slc16a4 UTSW 3 107311478 missense probably damaging 1.00
X0018:Slc16a4 UTSW 3 107300815 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGCATCCTGGTATTTTACTAG -3'
(R):5'- AGGAAGGCTGTTACTGTACTGAG -3'

Sequencing Primer
(F):5'- CACTATGAAACCATTTTTCCCTCC -3'
(R):5'- CTGGCAGTATTAGTGCCA -3'
Posted On2019-10-24