Incidental Mutation 'R7608:Epha7'
ID588423
Institutional Source Beutler Lab
Gene Symbol Epha7
Ensembl Gene ENSMUSG00000028289
Gene NameEph receptor A7
SynonymsEhk3, Hek11, Cek11, MDK1, Ebk, Mdk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location28813131-28967499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28871937 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 422 (S422L)
Ref Sequence ENSEMBL: ENSMUSP00000029964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000080934] [ENSMUST00000108191] [ENSMUST00000108194]
Predicted Effect probably benign
Transcript: ENSMUST00000029964
AA Change: S422L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: S422L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 557 630 4.4e-25 PFAM
TyrKc 633 890 8.84e-139 SMART
SAM 920 987 1.26e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080934
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079735
Gene: ENSMUSG00000028289
AA Change: S422L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108191
AA Change: S422L

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: S422L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 556 626 2.9e-23 PFAM
TyrKc 629 886 8.84e-139 SMART
SAM 916 983 1.26e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108194
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289
AA Change: S422L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Epha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Epha7 APN 4 28961285 intron probably benign
IGL00849:Epha7 APN 4 28870662 missense possibly damaging 0.63
IGL00898:Epha7 APN 4 28938693 missense probably damaging 1.00
IGL02036:Epha7 APN 4 28950509 missense probably damaging 1.00
IGL02227:Epha7 APN 4 28821587 missense possibly damaging 0.85
IGL02237:Epha7 APN 4 28949325 splice site probably null
IGL02376:Epha7 APN 4 28951287 missense probably damaging 1.00
IGL02424:Epha7 APN 4 28948790 intron probably benign
IGL02519:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02522:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02524:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02602:Epha7 APN 4 28871877 missense possibly damaging 0.88
PIT4514001:Epha7 UTSW 4 28961355 nonsense probably null
R0001:Epha7 UTSW 4 28961279 intron probably benign
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0310:Epha7 UTSW 4 28961301 missense probably benign 0.33
R0373:Epha7 UTSW 4 28935700 splice site probably null
R0496:Epha7 UTSW 4 28821292 missense probably damaging 1.00
R0554:Epha7 UTSW 4 28951401 missense probably damaging 1.00
R0632:Epha7 UTSW 4 28821104 missense probably damaging 1.00
R1677:Epha7 UTSW 4 28947571 nonsense probably null
R1883:Epha7 UTSW 4 28950362 missense possibly damaging 0.58
R1919:Epha7 UTSW 4 28963969 missense possibly damaging 0.48
R1952:Epha7 UTSW 4 28950474 missense probably damaging 0.97
R1999:Epha7 UTSW 4 28938686 nonsense probably null
R2187:Epha7 UTSW 4 28942648 missense possibly damaging 0.63
R2308:Epha7 UTSW 4 28821503 missense possibly damaging 0.91
R2417:Epha7 UTSW 4 28947579 missense probably damaging 1.00
R3911:Epha7 UTSW 4 28938680 missense probably benign 0.01
R4350:Epha7 UTSW 4 28950393 missense probably damaging 0.98
R4688:Epha7 UTSW 4 28821367 missense probably damaging 1.00
R4702:Epha7 UTSW 4 28961425 missense probably damaging 1.00
R4957:Epha7 UTSW 4 28871892 missense probably damaging 0.99
R5364:Epha7 UTSW 4 28950557 missense probably damaging 1.00
R5661:Epha7 UTSW 4 28946217 intron probably null
R5820:Epha7 UTSW 4 28949365 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6592:Epha7 UTSW 4 28813482 critical splice donor site probably null
R6783:Epha7 UTSW 4 28950528 missense possibly damaging 0.94
R6991:Epha7 UTSW 4 28821489 missense probably damaging 1.00
R7152:Epha7 UTSW 4 28935826 missense possibly damaging 0.94
R7232:Epha7 UTSW 4 28951279 missense probably damaging 1.00
R7261:Epha7 UTSW 4 28813418 missense probably benign 0.04
R7365:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7367:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7368:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7413:Epha7 UTSW 4 28871838 missense probably benign 0.00
R7603:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7604:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7605:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7607:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7609:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7610:Epha7 UTSW 4 28871937 missense probably benign 0.07
R8073:Epha7 UTSW 4 28821022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGTGTAAGCGGTGCAG -3'
(R):5'- TTTCCCCACCAGAACTATGGG -3'

Sequencing Primer
(F):5'- GCGGTGCAGTTGGGAAC -3'
(R):5'- CCAGAACTATGGGGATATTAAATGAC -3'
Posted On2019-10-24