Incidental Mutation 'R7608:Slc4a1ap'
ID588427
Institutional Source Beutler Lab
Gene Symbol Slc4a1ap
Ensembl Gene ENSMUSG00000029141
Gene Namesolute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonymskanadaptin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31526995-31556932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31536189 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 489 (M489K)
Ref Sequence ENSEMBL: ENSMUSP00000110179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114533] [ENSMUST00000201858] [ENSMUST00000202214] [ENSMUST00000202950]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114533
AA Change: M489K

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110179
Gene: ENSMUSG00000029141
AA Change: M489K

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201858
AA Change: M489K

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143960
Gene: ENSMUSG00000029141
AA Change: M489K

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 2e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000202214
AA Change: M489K

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141
AA Change: M489K

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202950
AA Change: M489K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141
AA Change: M489K

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Meta Mutation Damage Score 0.2268 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Slc4a1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Slc4a1ap APN 5 31553777 missense probably damaging 1.00
IGL01526:Slc4a1ap APN 5 31528227 missense possibly damaging 0.86
R1556:Slc4a1ap UTSW 5 31534210 splice site probably null
R1694:Slc4a1ap UTSW 5 31543754 missense probably damaging 1.00
R1884:Slc4a1ap UTSW 5 31534180 missense probably damaging 1.00
R3787:Slc4a1ap UTSW 5 31528139 missense possibly damaging 0.92
R4510:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4511:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4562:Slc4a1ap UTSW 5 31532029 missense probably damaging 1.00
R4828:Slc4a1ap UTSW 5 31530709 nonsense probably null
R5611:Slc4a1ap UTSW 5 31553829 utr 3 prime probably benign
R5648:Slc4a1ap UTSW 5 31550785 splice site probably null
R5991:Slc4a1ap UTSW 5 31534069 missense possibly damaging 0.92
R6531:Slc4a1ap UTSW 5 31548638 missense probably benign 0.18
R6602:Slc4a1ap UTSW 5 31527641 missense probably damaging 1.00
R6770:Slc4a1ap UTSW 5 31527882 intron probably null
R6844:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
R7103:Slc4a1ap UTSW 5 31543857 missense probably benign
R7342:Slc4a1ap UTSW 5 31536290 missense possibly damaging 0.89
R7378:Slc4a1ap UTSW 5 31527527 missense probably benign
R7527:Slc4a1ap UTSW 5 31534131 missense probably benign 0.04
R7603:Slc4a1ap UTSW 5 31546195 missense
R7781:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGTCTCACACAGCTATAG -3'
(R):5'- TAGCCCTCTGGGTAAACATTTAG -3'

Sequencing Primer
(F):5'- GCCCTTTGTTGGACTGAA -3'
(R):5'- CAGGCTAGCTACATGAGATACTGTC -3'
Posted On2019-10-24