Incidental Mutation 'R7608:Asz1'
ID588431
Institutional Source Beutler Lab
Gene Symbol Asz1
Ensembl Gene ENSMUSG00000010796
Gene Nameankyrin repeat, SAM and basic leucine zipper domain containing 1
Synonyms4933400N19Rik, ORF3, Gasz
MMRRC Submission
Accession Numbers

Genbank: NM_023729.3

Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location18050964-18109061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18077253 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 151 (T151M)
Ref Sequence ENSEMBL: ENSMUSP00000010940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010940] [ENSMUST00000136194]
Predicted Effect probably damaging
Transcript: ENSMUST00000010940
AA Change: T151M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010940
Gene: ENSMUSG00000010796
AA Change: T151M

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ANK 45 74 4.86e1 SMART
ANK 78 107 4.03e-5 SMART
ANK 110 144 2.3e0 SMART
ANK 148 177 3.46e-4 SMART
ANK 181 210 1.05e-3 SMART
SAM 271 336 5.64e-3 SMART
Blast:ANK 385 414 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136194
SMART Domains Protein: ENSMUSP00000122680
Gene: ENSMUSG00000010796

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ANK 45 74 4.86e1 SMART
ANK 78 107 4.03e-5 SMART
ANK 110 144 2.3e0 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous null male mice are sterile resulting from a block in spermatid development [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Asz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Asz1 APN 6 18055542 critical splice acceptor site probably null
IGL02691:Asz1 APN 6 18076557 missense probably damaging 1.00
IGL02958:Asz1 APN 6 18073814 missense possibly damaging 0.92
IGL03116:Asz1 APN 6 18076643 splice site probably benign
H9600:Asz1 UTSW 6 18055425 splice site probably benign
R0331:Asz1 UTSW 6 18103619 splice site probably benign
R3441:Asz1 UTSW 6 18108406 missense probably benign 0.06
R3896:Asz1 UTSW 6 18075767 missense probably benign 0.17
R4596:Asz1 UTSW 6 18103593 missense possibly damaging 0.82
R4683:Asz1 UTSW 6 18055542 critical splice acceptor site probably benign
R5304:Asz1 UTSW 6 18076620 missense probably benign 0.11
R5869:Asz1 UTSW 6 18074940 unclassified probably benign
R6550:Asz1 UTSW 6 18051381 missense probably damaging 0.96
R6672:Asz1 UTSW 6 18075818 missense possibly damaging 0.92
R6850:Asz1 UTSW 6 18108943 missense probably benign 0.00
R6894:Asz1 UTSW 6 18055521 missense probably damaging 1.00
R7092:Asz1 UTSW 6 18071819 intron probably null
R7388:Asz1 UTSW 6 18074901 missense probably benign 0.04
R7885:Asz1 UTSW 6 18104877 missense probably damaging 1.00
R7968:Asz1 UTSW 6 18104877 missense probably damaging 1.00
X0054:Asz1 UTSW 6 18055481 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGCTCTTACCAGGCCAAG -3'
(R):5'- AGTGTGGTTGATAGAACTCTGATAC -3'

Sequencing Primer
(F):5'- GCCAAACTACCCATTTGTGTAGG -3'
(R):5'- ACTCAATTGTGTTTTTAAAACTTGCC -3'
Posted On2019-10-24