Incidental Mutation 'R0624:Slc9c1'
ID 58844
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 038813-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R0624 (G1)
Quality Score 213
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45393719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 554 (E554G)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: E554G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: E554G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.1602 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,030,446 (GRCm39) D767V probably damaging Het
Add1 T A 5: 34,763,197 (GRCm39) N128K probably damaging Het
Ado A T 10: 67,384,058 (GRCm39) D182E probably benign Het
Anapc4 T A 5: 53,002,761 (GRCm39) probably benign Het
Ano10 A G 9: 122,088,661 (GRCm39) probably benign Het
Apba2 A G 7: 64,364,263 (GRCm39) probably null Het
Apc2 A G 10: 80,150,417 (GRCm39) T1795A probably benign Het
Atp4a A G 7: 30,418,424 (GRCm39) N571D probably benign Het
Birc6 A G 17: 74,887,344 (GRCm39) N891D probably benign Het
Bltp2 G A 11: 78,159,283 (GRCm39) E494K probably damaging Het
Car3 G T 3: 14,931,864 (GRCm39) M78I probably benign Het
Cc2d2a A T 5: 43,887,371 (GRCm39) H1267L probably benign Het
Cdk18 A G 1: 132,046,610 (GRCm39) L192P probably damaging Het
Cdk9 A T 2: 32,599,836 (GRCm39) Y134N probably damaging Het
Ceacam5 A T 7: 17,448,888 (GRCm39) T85S probably benign Het
Cenpe A G 3: 134,952,347 (GRCm39) T1403A probably benign Het
Chd8 C T 14: 52,457,214 (GRCm39) G918D possibly damaging Het
Csnk1e T A 15: 79,304,098 (GRCm39) probably benign Het
Dctpp1 A T 7: 126,856,365 (GRCm39) I119N probably damaging Het
Defb34 T A 8: 19,173,784 (GRCm39) F6Y unknown Het
Dnai4 T C 4: 102,930,054 (GRCm39) probably benign Het
Dvl1 C G 4: 155,939,232 (GRCm39) N248K probably damaging Het
Dync1h1 T C 12: 110,618,181 (GRCm39) probably benign Het
Dync2i1 T C 12: 116,211,910 (GRCm39) D199G probably damaging Het
Eml5 T A 12: 98,831,738 (GRCm39) R407W probably damaging Het
Epb41l5 T C 1: 119,551,688 (GRCm39) D99G probably damaging Het
Fat1 A T 8: 45,504,205 (GRCm39) N4566I possibly damaging Het
Gm21834 T C 17: 58,049,015 (GRCm39) E67G possibly damaging Het
Gsap T A 5: 21,458,949 (GRCm39) probably null Het
Guf1 T C 5: 69,715,923 (GRCm39) I108T probably damaging Het
Hsd3b5 T C 3: 98,526,720 (GRCm39) D242G probably damaging Het
Kcna7 A G 7: 45,059,114 (GRCm39) D467G probably null Het
Lars1 A G 18: 42,375,849 (GRCm39) probably benign Het
Lrrc56 A T 7: 140,786,366 (GRCm39) D248V probably damaging Het
Map3k14 T A 11: 103,133,117 (GRCm39) E27V possibly damaging Het
Med12l G A 3: 58,945,123 (GRCm39) W116* probably null Het
Mgll A G 6: 88,702,799 (GRCm39) R33G probably damaging Het
Mmp13 A G 9: 7,280,221 (GRCm39) S384G possibly damaging Het
Nalcn C T 14: 123,607,444 (GRCm39) C675Y probably benign Het
Nrxn1 A G 17: 91,396,117 (GRCm39) L13P unknown Het
Ocstamp A G 2: 165,239,772 (GRCm39) V138A probably damaging Het
Or12e8 T G 2: 87,188,026 (GRCm39) Y79* probably null Het
Or2z8 T A 8: 72,812,006 (GRCm39) S161T possibly damaging Het
Or4a68 A G 2: 89,270,482 (GRCm39) V47A possibly damaging Het
Or4f7 T C 2: 111,645,056 (GRCm39) N5S probably damaging Het
Or5p51 A G 7: 107,444,323 (GRCm39) S206P possibly damaging Het
Or9i1b T G 19: 13,896,808 (GRCm39) C141W probably damaging Het
Patj T C 4: 98,569,472 (GRCm39) probably benign Het
Pcdhb22 A G 18: 37,651,780 (GRCm39) I83V probably benign Het
Pclo A G 5: 14,719,670 (GRCm39) E1269G unknown Het
Plagl2 T C 2: 153,077,973 (GRCm39) T3A probably benign Het
Plcb1 C T 2: 135,136,831 (GRCm39) P309S possibly damaging Het
Pld3 A T 7: 27,239,000 (GRCm39) L175Q possibly damaging Het
Prrx1 A G 1: 163,075,974 (GRCm39) probably benign Het
Psap T G 10: 60,135,345 (GRCm39) probably benign Het
Ptgfr G A 3: 151,540,839 (GRCm39) T223M probably damaging Het
Reep2 A T 18: 34,973,824 (GRCm39) I6F probably benign Het
Rraga A G 4: 86,494,454 (GRCm39) E100G probably benign Het
Rrm2b T C 15: 37,931,889 (GRCm39) D37G probably benign Het
Rtl1 T C 12: 109,559,153 (GRCm39) I895M probably damaging Het
Ryr1 G A 7: 28,774,034 (GRCm39) A2445V probably damaging Het
Sbf1 C T 15: 89,186,532 (GRCm39) D898N possibly damaging Het
Sh3d19 G A 3: 86,022,213 (GRCm39) V548I possibly damaging Het
Shf C A 2: 122,199,116 (GRCm39) probably benign Het
Sipa1l3 T C 7: 29,086,676 (GRCm39) E638G probably damaging Het
Slc13a3 G T 2: 165,253,807 (GRCm39) P449T probably damaging Het
Slc2a13 C T 15: 91,234,215 (GRCm39) V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 (GRCm38) probably null Het
Slc7a2 T A 8: 41,361,568 (GRCm39) S414T probably benign Het
Smad2 T C 18: 76,433,064 (GRCm39) I332T probably damaging Het
Snrnp40 C T 4: 130,256,451 (GRCm39) P59S probably damaging Het
Sorcs2 A T 5: 36,222,777 (GRCm39) I154N probably damaging Het
Sort1 G A 3: 108,255,946 (GRCm39) G631S probably damaging Het
Sox10 T C 15: 79,043,586 (GRCm39) D149G possibly damaging Het
Spn C T 7: 126,735,380 (GRCm39) V376M possibly damaging Het
Tacc2 A G 7: 130,179,239 (GRCm39) D9G probably damaging Het
Tapt1 T G 5: 44,334,448 (GRCm39) L514F possibly damaging Het
Tcf3 A G 10: 80,249,168 (GRCm39) L480P probably damaging Het
Tenm4 G C 7: 96,423,227 (GRCm39) G637A probably damaging Het
Tex14 T A 11: 87,411,525 (GRCm39) N950K probably benign Het
Tgfbrap1 T G 1: 43,098,289 (GRCm39) H497P probably benign Het
Tnfrsf18 A T 4: 156,110,986 (GRCm39) Y48F possibly damaging Het
Tnxb A C 17: 34,902,522 (GRCm39) H1002P probably damaging Het
Ttn A G 2: 76,593,571 (GRCm39) probably benign Het
Ugt2b34 C G 5: 87,041,591 (GRCm39) probably null Het
Vldlr A G 19: 27,215,663 (GRCm39) D220G possibly damaging Het
Vmn1r33 A T 6: 66,589,121 (GRCm39) Y144* probably null Het
Xrcc4 T C 13: 90,140,594 (GRCm39) E205G possibly damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTGTGAACTATTTGGCAACAGGG -3'
(R):5'- TGCGGAGACTAAGGAACACTTGGC -3'

Sequencing Primer
(F):5'- ttggcaacagggaattcaac -3'
(R):5'- CCCTATGCAGGTGTTCAGAGAG -3'
Posted On 2013-07-11