Incidental Mutation 'R7608:Olfr924'
ID588444
Institutional Source Beutler Lab
Gene Symbol Olfr924
Ensembl Gene ENSMUSG00000062103
Gene Nameolfactory receptor 924
SynonymsMOR171-27P, GA_x6K02T2PVTD-32543982-32544908, Olfr1520-ps1, MOR171-27P, MOR171-47
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38844449-38851495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38848510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 132 (V132D)
Ref Sequence ENSEMBL: ENSMUSP00000149849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072977] [ENSMUST00000217350]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072977
AA Change: V132D

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072744
Gene: ENSMUSG00000062103
AA Change: V132D

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 4.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 32 279 7.2e-7 PFAM
Pfam:7tm_1 38 287 1.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217350
AA Change: V132D

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2279 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Olfr924
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr924 APN 9 38848252 missense probably damaging 1.00
IGL01673:Olfr924 APN 9 38849020 missense probably benign 0.00
IGL01769:Olfr924 APN 9 38848333 missense probably benign 0.01
IGL02015:Olfr924 APN 9 38848794 missense probably damaging 0.99
IGL02525:Olfr924 APN 9 38848240 missense possibly damaging 0.82
IGL02728:Olfr924 APN 9 38848926 missense probably damaging 1.00
IGL02944:Olfr924 APN 9 38848752 missense possibly damaging 0.88
IGL03127:Olfr924 APN 9 38848209 missense probably damaging 1.00
R0613:Olfr924 UTSW 9 38848613 nonsense probably null
R0811:Olfr924 UTSW 9 38848509 missense probably benign
R0812:Olfr924 UTSW 9 38848509 missense probably benign
R1558:Olfr924 UTSW 9 38848904 missense probably benign 0.00
R1604:Olfr924 UTSW 9 38848704 missense probably benign 0.04
R1681:Olfr924 UTSW 9 38848513 missense probably damaging 1.00
R1730:Olfr924 UTSW 9 38848972 missense probably damaging 1.00
R1783:Olfr924 UTSW 9 38848972 missense probably damaging 1.00
R1791:Olfr924 UTSW 9 38848605 missense possibly damaging 0.75
R2144:Olfr924 UTSW 9 38848339 missense probably damaging 1.00
R5741:Olfr924 UTSW 9 38848603 nonsense probably null
R6521:Olfr924 UTSW 9 38848597 missense probably benign
R6808:Olfr924 UTSW 9 38848789 missense probably damaging 1.00
R7741:Olfr924 UTSW 9 38848318 missense probably damaging 1.00
RF004:Olfr924 UTSW 9 38848818 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTCTGTCATTACACCAAAGATGTTG -3'
(R):5'- ACAGCCAGTGTAGGTGCAAG -3'

Sequencing Primer
(F):5'- TGGTGAACTTTGTATGTGAGAAGAAC -3'
(R):5'- TAGGTGCAAGGGTATTAACTCCACC -3'
Posted On2019-10-24