Incidental Mutation 'R7608:Lrrc49'
ID588445
Institutional Source Beutler Lab
Gene Symbol Lrrc49
Ensembl Gene ENSMUSG00000047766
Gene Nameleucine rich repeat containing 49
SynonymsD430025H09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location60568859-60688158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60602722 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 488 (G488S)
Ref Sequence ENSEMBL: ENSMUSP00000070606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053171] [ENSMUST00000065603] [ENSMUST00000114032] [ENSMUST00000114034] [ENSMUST00000150060] [ENSMUST00000166168]
Predicted Effect probably null
Transcript: ENSMUST00000053171
AA Change: G128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057014
Gene: ENSMUSG00000047766
AA Change: G128S

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000065603
AA Change: G488S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070606
Gene: ENSMUSG00000047766
AA Change: G488S

DomainStartEndE-ValueType
LRR 199 221 2.84e1 SMART
LRR 243 264 1.49e1 SMART
LRR 265 286 1.37e2 SMART
LRR 287 308 1.62e1 SMART
LRR 309 332 6.77e0 SMART
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114032
AA Change: G416S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109666
Gene: ENSMUSG00000047766
AA Change: G416S

DomainStartEndE-ValueType
LRR 127 149 2.84e1 SMART
LRR 171 192 1.49e1 SMART
LRR 193 214 1.37e2 SMART
LRR 215 236 1.62e1 SMART
LRR 237 260 6.77e0 SMART
low complexity region 306 322 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114034
AA Change: G422S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109668
Gene: ENSMUSG00000047766
AA Change: G422S

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150060
SMART Domains Protein: ENSMUSP00000118205
Gene: ENSMUSG00000047766

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166168
AA Change: G482S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128842
Gene: ENSMUSG00000047766
AA Change: G482S

DomainStartEndE-ValueType
LRR 193 215 2.84e1 SMART
LRR 237 258 1.49e1 SMART
LRR 259 280 1.37e2 SMART
LRR 281 302 1.62e1 SMART
LRR 303 326 6.77e0 SMART
low complexity region 372 388 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Lrrc49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lrrc49 APN 9 60601320 missense probably damaging 1.00
IGL00468:Lrrc49 APN 9 60687868 unclassified probably benign
IGL00792:Lrrc49 APN 9 60687838 missense probably damaging 0.97
IGL02252:Lrrc49 APN 9 60687859 start codon destroyed probably benign 0.04
IGL02830:Lrrc49 APN 9 60685110 missense probably damaging 1.00
IGL03103:Lrrc49 APN 9 60685033 critical splice donor site probably null
IGL03223:Lrrc49 APN 9 60687845 missense possibly damaging 0.72
IGL03244:Lrrc49 APN 9 60587857 missense probably damaging 1.00
IGL03392:Lrrc49 APN 9 60666280 splice site probably benign
IGL02837:Lrrc49 UTSW 9 60610322 missense probably benign 0.00
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0335:Lrrc49 UTSW 9 60677095 missense probably damaging 0.99
R0399:Lrrc49 UTSW 9 60610246 splice site probably benign
R0607:Lrrc49 UTSW 9 60666357 missense probably benign 0.35
R1396:Lrrc49 UTSW 9 60680527 missense probably damaging 0.99
R1731:Lrrc49 UTSW 9 60621631 missense probably damaging 1.00
R1800:Lrrc49 UTSW 9 60598191 missense probably damaging 1.00
R1817:Lrrc49 UTSW 9 60602776 missense possibly damaging 0.94
R1876:Lrrc49 UTSW 9 60587777 missense possibly damaging 0.77
R1925:Lrrc49 UTSW 9 60649490 missense probably benign 0.07
R2172:Lrrc49 UTSW 9 60602682 missense probably benign 0.25
R2233:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2235:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2927:Lrrc49 UTSW 9 60593746 nonsense probably null
R3955:Lrrc49 UTSW 9 60671359 missense probably damaging 1.00
R4214:Lrrc49 UTSW 9 60666326 missense probably benign 0.33
R4772:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R5283:Lrrc49 UTSW 9 60687178 missense probably benign 0.06
R5801:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6115:Lrrc49 UTSW 9 60615161 missense possibly damaging 0.61
R6488:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6525:Lrrc49 UTSW 9 60598149 missense probably damaging 1.00
R6540:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R6550:Lrrc49 UTSW 9 60677147 missense probably benign 0.13
R6603:Lrrc49 UTSW 9 60593769 splice site probably null
R6878:Lrrc49 UTSW 9 60680148 missense probably damaging 0.99
R7144:Lrrc49 UTSW 9 60615156 missense probably damaging 0.99
R7336:Lrrc49 UTSW 9 60677191 missense possibly damaging 0.92
R7541:Lrrc49 UTSW 9 60610403 missense probably damaging 1.00
R7739:Lrrc49 UTSW 9 60593692 missense probably benign
Z1176:Lrrc49 UTSW 9 60677221 missense probably damaging 0.99
Z1177:Lrrc49 UTSW 9 60598093 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAAGTTGAAGCAGGCTTTGG -3'
(R):5'- TAAAGCACTTTCCAACATGCTGTTC -3'

Sequencing Primer
(F):5'- CTTTGGCCTGAACACACAAGTTG -3'
(R):5'- CTAGCCTGTTACTTCCTTTGTGTG -3'
Posted On2019-10-24