Incidental Mutation 'R7608:Txlnb'
ID588447
Institutional Source Beutler Lab
Gene Symbol Txlnb
Ensembl Gene ENSMUSG00000039891
Gene Nametaxilin beta
Synonyms2310001N14Rik, Mdp77
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location17796226-17845665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17815398 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 232 (K232R)
Ref Sequence ENSEMBL: ENSMUSP00000044936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037964]
Predicted Effect probably damaging
Transcript: ENSMUST00000037964
AA Change: K232R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044936
Gene: ENSMUSG00000039891
AA Change: K232R

DomainStartEndE-ValueType
internal_repeat_2 5 22 2.13e-6 PROSPERO
internal_repeat_1 25 93 4.27e-8 PROSPERO
low complexity region 115 128 N/A INTRINSIC
Pfam:Taxilin 145 454 3.1e-122 PFAM
low complexity region 477 491 N/A INTRINSIC
internal_repeat_2 543 560 2.13e-6 PROSPERO
low complexity region 575 591 N/A INTRINSIC
internal_repeat_1 600 659 4.27e-8 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Txlnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Txlnb APN 10 17842963 missense probably damaging 0.98
IGL01820:Txlnb APN 10 17806858 critical splice donor site probably null
IGL02244:Txlnb APN 10 17843368 missense probably benign 0.00
IGL02247:Txlnb APN 10 17830342 missense possibly damaging 0.55
IGL02247:Txlnb APN 10 17841528 splice site probably benign
IGL02931:Txlnb APN 10 17827982 missense probably damaging 1.00
IGL03006:Txlnb APN 10 17838975 missense probably damaging 0.96
IGL02991:Txlnb UTSW 10 17841453 missense probably damaging 1.00
R0092:Txlnb UTSW 10 17842755 missense possibly damaging 0.91
R0800:Txlnb UTSW 10 17799492 missense possibly damaging 0.50
R0908:Txlnb UTSW 10 17799177 missense probably damaging 1.00
R1172:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1174:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1340:Txlnb UTSW 10 17842740 missense probably damaging 1.00
R1373:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1641:Txlnb UTSW 10 17806773 missense possibly damaging 0.55
R1680:Txlnb UTSW 10 17843233 missense probably benign 0.01
R1710:Txlnb UTSW 10 17843455 missense possibly damaging 0.90
R1741:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1955:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R2031:Txlnb UTSW 10 17830314 missense possibly damaging 0.85
R4300:Txlnb UTSW 10 17827925 missense probably damaging 1.00
R4483:Txlnb UTSW 10 17838997 nonsense probably null
R4484:Txlnb UTSW 10 17838997 nonsense probably null
R4656:Txlnb UTSW 10 17815276 missense probably damaging 1.00
R4664:Txlnb UTSW 10 17843194 missense probably damaging 0.99
R4723:Txlnb UTSW 10 17799267 missense probably benign 0.02
R4974:Txlnb UTSW 10 17838969 missense probably damaging 1.00
R5291:Txlnb UTSW 10 17799396 missense possibly damaging 0.92
R5538:Txlnb UTSW 10 17838909 missense probably damaging 1.00
R5791:Txlnb UTSW 10 17799128 missense probably benign 0.01
R5967:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R6144:Txlnb UTSW 10 17843166 missense probably benign 0.17
R6212:Txlnb UTSW 10 17799309 missense probably damaging 1.00
R7146:Txlnb UTSW 10 17827798 missense possibly damaging 0.81
R7171:Txlnb UTSW 10 17842984 missense probably benign 0.22
R7253:Txlnb UTSW 10 17827885 missense probably damaging 1.00
R7468:Txlnb UTSW 10 17799334 missense probably damaging 0.96
X0025:Txlnb UTSW 10 17799422 missense probably benign 0.39
Z1177:Txlnb UTSW 10 17806806 missense probably benign 0.33
Z1177:Txlnb UTSW 10 17827804 missense probably damaging 1.00
Z1177:Txlnb UTSW 10 17833308 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCAAATTCCCTGCTGCTTG -3'
(R):5'- CCTTCCGAGCATAGTCAGAAG -3'

Sequencing Primer
(F):5'- GTACCCCCACATCTAGCTGGATG -3'
(R):5'- CTTCCGAGCATAGTCAGAAGATGGG -3'
Posted On2019-10-24