Incidental Mutation 'R7608:Prpf39'
ID 588448
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Name pre-mRNA processing factor 39
Synonyms Srcs1
MMRRC Submission 045678-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R7608 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 65083107-65110160 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65100220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 298 (A298T)
Ref Sequence ENSEMBL: ENSMUSP00000112953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120580] [ENSMUST00000129956] [ENSMUST00000223315]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000120580
AA Change: A298T

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597
AA Change: A298T

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129956
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000223315
AA Change: A179T

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,154,347 (GRCm39) F311S probably benign Het
Adamts7 C A 9: 90,055,826 (GRCm39) T193N possibly damaging Het
Akr1b7 A G 6: 34,397,457 (GRCm39) N273S probably damaging Het
Asz1 G A 6: 18,077,252 (GRCm39) T151M probably damaging Het
Atosb A G 4: 43,036,533 (GRCm39) L66P probably damaging Het
Atrnl1 T A 19: 57,703,119 (GRCm39) Y1046N probably damaging Het
Cacna2d1 T C 5: 16,564,022 (GRCm39) S902P probably damaging Het
Casp3 T A 8: 47,087,368 (GRCm39) I105K probably benign Het
Ccdc146 C T 5: 21,506,450 (GRCm39) V664I probably benign Het
Cfap61 G A 2: 145,805,451 (GRCm39) C267Y possibly damaging Het
Dgkz A T 2: 91,764,399 (GRCm39) probably null Het
Dnah11 G T 12: 118,104,505 (GRCm39) probably null Het
Duox1 C A 2: 122,156,616 (GRCm39) Y514* probably null Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Fan1 A T 7: 64,003,979 (GRCm39) probably null Het
Fgfrl1 A T 5: 108,853,211 (GRCm39) K278M probably damaging Het
Fign T C 2: 63,809,063 (GRCm39) I736V possibly damaging Het
Galns A G 8: 123,318,184 (GRCm39) F410S probably benign Het
Hspbp1 C A 7: 4,663,821 (GRCm39) K341N possibly damaging Het
Idh3b A T 2: 130,122,900 (GRCm39) S296R probably damaging Het
Ifi44 A G 3: 151,438,045 (GRCm39) F414S probably damaging Het
Kdm3a T A 6: 71,577,731 (GRCm39) M690L probably benign Het
Ldaf1 A G 7: 119,704,011 (GRCm39) K19E probably damaging Het
Lrrc49 C T 9: 60,510,005 (GRCm39) G488S probably null Het
Mcc T C 18: 44,624,294 (GRCm39) N417S possibly damaging Het
Melk T A 4: 44,325,571 (GRCm39) probably null Het
Mtcl1 T C 17: 66,650,300 (GRCm39) R1722G probably damaging Het
Or4a79 A G 2: 89,551,642 (GRCm39) V271A probably benign Het
Or51f23c-ps1 A G 7: 102,431,132 (GRCm39) I150V probably benign Het
Or5b119 G A 19: 13,456,956 (GRCm39) T202I possibly damaging Het
Or8d2 T A 9: 38,759,806 (GRCm39) V132D possibly damaging Het
Pdzrn3 T C 6: 101,128,713 (GRCm39) E651G probably damaging Het
Pop5 A G 5: 115,375,931 (GRCm39) probably benign Het
Prox1 T A 1: 189,885,642 (GRCm39) M602L probably benign Het
Scg2 T C 1: 79,413,898 (GRCm39) E275G probably benign Het
Scn11a A T 9: 119,644,379 (GRCm39) probably null Het
Slc16a4 A T 3: 107,210,443 (GRCm39) Y371F probably damaging Het
Slc4a1ap T A 5: 31,693,533 (GRCm39) M489K possibly damaging Het
Spata13 A G 14: 60,929,956 (GRCm39) N505D possibly damaging Het
Tas2r129 A G 6: 132,928,156 (GRCm39) N31S probably damaging Het
Tnn A T 1: 159,915,984 (GRCm39) Y1508* probably null Het
Trim23 T C 13: 104,328,541 (GRCm39) V354A probably benign Het
Tsc1 A T 2: 28,548,748 (GRCm39) T18S probably benign Het
Txlnb A G 10: 17,691,146 (GRCm39) K232R probably damaging Het
Vmn1r53 C T 6: 90,201,104 (GRCm39) M73I probably benign Het
Vmn1r67 G A 7: 10,181,290 (GRCm39) V185M possibly damaging Het
Vmn2r14 A G 5: 109,369,276 (GRCm39) I99T probably benign Het
Zfp318 T G 17: 46,710,935 (GRCm39) V886G probably damaging Het
Zfp760 A G 17: 21,941,797 (GRCm39) N324S probably benign Het
Zfp819 T C 7: 43,266,357 (GRCm39) V280A probably benign Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65,090,037 (GRCm39) missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65,089,255 (GRCm39) unclassified probably benign
IGL01323:Prpf39 APN 12 65,089,498 (GRCm39) missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65,104,510 (GRCm39) missense probably benign 0.02
IGL02966:Prpf39 APN 12 65,089,553 (GRCm39) missense probably benign 0.45
IGL03189:Prpf39 APN 12 65,090,076 (GRCm39) nonsense probably null
IGL03357:Prpf39 APN 12 65,108,211 (GRCm39) unclassified probably benign
R0103:Prpf39 UTSW 12 65,102,057 (GRCm39) missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65,102,057 (GRCm39) missense possibly damaging 0.56
R0328:Prpf39 UTSW 12 65,090,145 (GRCm39) splice site probably benign
R0549:Prpf39 UTSW 12 65,103,030 (GRCm39) missense probably benign 0.05
R0840:Prpf39 UTSW 12 65,094,980 (GRCm39) missense probably benign 0.21
R1248:Prpf39 UTSW 12 65,100,740 (GRCm39) splice site probably benign
R1322:Prpf39 UTSW 12 65,089,436 (GRCm39) missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65,100,088 (GRCm39) missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65,104,689 (GRCm39) critical splice donor site probably null
R2232:Prpf39 UTSW 12 65,090,786 (GRCm39) nonsense probably null
R2507:Prpf39 UTSW 12 65,104,589 (GRCm39) missense probably benign 0.36
R2508:Prpf39 UTSW 12 65,104,589 (GRCm39) missense probably benign 0.36
R2959:Prpf39 UTSW 12 65,089,297 (GRCm39) missense probably damaging 1.00
R3117:Prpf39 UTSW 12 65,104,651 (GRCm39) missense possibly damaging 0.79
R3118:Prpf39 UTSW 12 65,104,651 (GRCm39) missense possibly damaging 0.79
R3980:Prpf39 UTSW 12 65,108,231 (GRCm39) unclassified probably benign
R4407:Prpf39 UTSW 12 65,103,040 (GRCm39) missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65,089,337 (GRCm39) missense probably benign
R4926:Prpf39 UTSW 12 65,090,830 (GRCm39) missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65,095,051 (GRCm39) missense probably benign 0.29
R6248:Prpf39 UTSW 12 65,089,528 (GRCm39) missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65,089,587 (GRCm39) splice site probably null
R6614:Prpf39 UTSW 12 65,089,337 (GRCm39) missense probably benign
R6749:Prpf39 UTSW 12 65,103,048 (GRCm39) missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65,089,454 (GRCm39) missense probably benign 0.03
R7023:Prpf39 UTSW 12 65,100,074 (GRCm39) missense possibly damaging 0.94
R7503:Prpf39 UTSW 12 65,100,167 (GRCm39) missense probably benign 0.04
R7532:Prpf39 UTSW 12 65,100,145 (GRCm39) missense probably benign 0.00
R8286:Prpf39 UTSW 12 65,103,132 (GRCm39) missense probably benign
R8439:Prpf39 UTSW 12 65,102,036 (GRCm39) missense possibly damaging 0.95
R8787:Prpf39 UTSW 12 65,089,555 (GRCm39) missense possibly damaging 0.95
R9101:Prpf39 UTSW 12 65,090,078 (GRCm39) missense probably damaging 1.00
R9153:Prpf39 UTSW 12 65,106,671 (GRCm39) missense probably damaging 0.99
R9448:Prpf39 UTSW 12 65,108,034 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACTGCAAAGACAGTGGG -3'
(R):5'- CTACAATAGGAATAGTAGACTGCAATC -3'

Sequencing Primer
(F):5'- TACATAGGAGGTATCTGACAAGTG -3'
(R):5'- GTTACTTCCAGGTGTGTC -3'
Posted On 2019-10-24