Incidental Mutation 'R7608:Spata13'
ID588450
Institutional Source Beutler Lab
Gene Symbol Spata13
Ensembl Gene ENSMUSG00000021990
Gene Namespermatogenesis associated 13
SynonymsESTM11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location60634001-60764556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60692507 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 505 (N505D)
Ref Sequence ENSEMBL: ENSMUSP00000123928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022566] [ENSMUST00000159169] [ENSMUST00000159729] [ENSMUST00000160973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022566
AA Change: N505D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022566
Gene: ENSMUSG00000021990
AA Change: N505D

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159169
Predicted Effect probably benign
Transcript: ENSMUST00000159729
Predicted Effect
SMART Domains Protein: ENSMUSP00000123744
Gene: ENSMUSG00000021990
AA Change: N178D

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 100 124 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160973
AA Change: N505D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123928
Gene: ENSMUSG00000021990
AA Change: N505D

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal but show a significant reduction in the number and size of intestinal adenomas in conjunction with ApcMin heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Spata13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Spata13 APN 14 60691274 missense probably damaging 1.00
IGL02455:Spata13 APN 14 60706714 missense probably benign 0.01
IGL03189:Spata13 APN 14 60691614 missense possibly damaging 0.71
IGL03235:Spata13 APN 14 60751792 missense probably damaging 1.00
PIT4378001:Spata13 UTSW 14 60749996 missense probably damaging 1.00
R0278:Spata13 UTSW 14 60692088 missense probably benign 0.02
R0316:Spata13 UTSW 14 60692339 missense probably benign
R0458:Spata13 UTSW 14 60692043 missense probably damaging 0.98
R1546:Spata13 UTSW 14 60756408 missense probably damaging 1.00
R1780:Spata13 UTSW 14 60691725 missense probably damaging 0.96
R1791:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R1970:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R2059:Spata13 UTSW 14 60759591 missense possibly damaging 0.79
R2063:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2068:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2212:Spata13 UTSW 14 60706723 missense probably benign 0.00
R2327:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R3414:Spata13 UTSW 14 60706723 missense probably benign 0.00
R4115:Spata13 UTSW 14 60692478 missense probably damaging 1.00
R4276:Spata13 UTSW 14 60756296 missense probably damaging 1.00
R4289:Spata13 UTSW 14 60691074 missense probably damaging 1.00
R4291:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4293:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4294:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4295:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4779:Spata13 UTSW 14 60753907 nonsense probably null
R4780:Spata13 UTSW 14 60753907 nonsense probably null
R4838:Spata13 UTSW 14 60733179 missense probably benign 0.17
R4997:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R5066:Spata13 UTSW 14 60750089 missense possibly damaging 0.78
R5399:Spata13 UTSW 14 60747541 missense probably benign 0.00
R5685:Spata13 UTSW 14 60691203 missense probably benign 0.00
R5708:Spata13 UTSW 14 60692003 missense probably damaging 1.00
R5747:Spata13 UTSW 14 60747503 missense probably benign 0.00
R6073:Spata13 UTSW 14 60750021 missense probably damaging 1.00
R6135:Spata13 UTSW 14 60756428 missense probably damaging 0.98
R6233:Spata13 UTSW 14 60692007 missense probably benign 0.06
R6782:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R6873:Spata13 UTSW 14 60691957 missense probably benign
R6958:Spata13 UTSW 14 60751851 missense possibly damaging 0.94
R7105:Spata13 UTSW 14 60753870 missense probably damaging 0.97
R7286:Spata13 UTSW 14 60756422 missense probably damaging 1.00
R7512:Spata13 UTSW 14 60751777 missense probably damaging 1.00
R7565:Spata13 UTSW 14 60751849 missense probably damaging 1.00
R7743:Spata13 UTSW 14 60756249 missense probably damaging 0.99
R7795:Spata13 UTSW 14 60691842 missense possibly damaging 0.92
R8073:Spata13 UTSW 14 60691256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGTGCCCCAGTAGTCTG -3'
(R):5'- AACCTGGAACCTTGCACGTG -3'

Sequencing Primer
(F):5'- CCCAGTAGTCTGAGTGTGC -3'
(R):5'- GTGCCACGTAAACACCTGG -3'
Posted On2019-10-24