Incidental Mutation 'R7609:Phf3'
ID588457
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7609 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30805501 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1459 (Y1459C)
Ref Sequence ENSEMBL: ENSMUSP00000085650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]
Predicted Effect probably benign
Transcript: ENSMUST00000088310
AA Change: Y1459C

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: Y1459C

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186733
AA Change: Y1459C

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: Y1459C

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191329
SMART Domains Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
Pfam:SPOC 1 88 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,989,460 Y288C probably benign Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Agl C A 3: 116,807,279 R24I possibly damaging Het
Aldoart2 A G 12: 55,566,048 T253A probably benign Het
Ankrd39 G A 1: 36,539,465 R160W probably damaging Het
Aspscr1 C T 11: 120,677,522 T57M probably damaging Het
Baz2b A G 2: 59,962,473 L437S probably benign Het
Bcl9l T A 9: 44,505,747 L331Q probably damaging Het
Cdhr4 C A 9: 107,997,283 P546T probably damaging Het
Cfap61 T C 2: 146,112,533 C231R unknown Het
Cnih4 T C 1: 181,155,902 L61P probably damaging Het
Dtx4 A G 19: 12,492,281 Y161H probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ercc6 A G 14: 32,566,361 H830R probably benign Het
Exoc7 T C 11: 116,289,259 N673S possibly damaging Het
Gm12185 T C 11: 48,916,023 S114G possibly damaging Het
Hsfy2 A T 1: 56,637,151 F76I probably benign Het
Igsf9b A G 9: 27,345,890 D1413G probably benign Het
Klk8 G A 7: 43,802,179 C198Y probably damaging Het
Lama3 G T 18: 12,531,834 probably null Het
Lce3f A T 3: 92,993,096 S75C unknown Het
Ldhal6b T C 17: 5,417,991 M223V probably benign Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
Mc1r A T 8: 123,408,293 I262F probably damaging Het
Mecom A G 3: 29,956,442 I629T probably damaging Het
Mkrn2os A G 6: 115,586,726 V116A possibly damaging Het
Muc5b T A 7: 141,861,729 V2804D possibly damaging Het
Myo15 T C 11: 60,488,811 V279A Het
Nhlrc2 A G 19: 56,594,896 I600V probably benign Het
Nipbl T C 15: 8,305,872 Q2183R probably benign Het
Obscn C T 11: 59,000,299 E7136K unknown Het
Olfr1118 T C 2: 87,309,509 V260A probably benign Het
Olfr25 A C 9: 38,330,224 L209F possibly damaging Het
Olfr481 T A 7: 108,081,546 F251I probably damaging Het
Olfr970 C T 9: 39,820,287 T216I probably benign Het
Otop3 T C 11: 115,339,720 I141T possibly damaging Het
Pde4dip C A 3: 97,715,565 V1443F possibly damaging Het
Pdgfra T C 5: 75,166,721 V193A probably benign Het
Pias4 A T 10: 81,158,026 probably null Het
Plcg2 A G 8: 117,558,113 N159S probably benign Het
Plekha7 T C 7: 116,164,446 D307G probably benign Het
Ptprd T C 4: 76,072,003 K491E probably benign Het
Rbpjl A T 2: 164,405,814 R62S probably benign Het
Rgs11 T C 17: 26,207,441 S245P probably damaging Het
Ripor3 G A 2: 167,984,570 A685V possibly damaging Het
Rnase9 G A 14: 51,039,483 P13S possibly damaging Het
Scin C T 12: 40,124,589 C165Y probably damaging Het
Senp7 T C 16: 56,111,637 W100R probably benign Het
Slc26a2 T C 18: 61,198,460 D633G probably benign Het
Slc4a4 C T 5: 89,135,686 P446S probably damaging Het
Soga3 A T 10: 29,148,228 D380V probably damaging Het
Spag17 T A 3: 100,095,595 C1878* probably null Het
Ssc5d A G 7: 4,927,576 E129G possibly damaging Het
Supt6 T C 11: 78,226,951 N480D probably benign Het
Tbk1 A G 10: 121,552,501 L590S probably damaging Het
Tex45 A T 8: 3,476,057 H70L probably benign Het
Tmem63a T A 1: 180,952,974 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A G 15: 27,912,642 S109P unknown Het
Tsga10 A T 1: 37,804,893 probably null Het
Ttn A T 2: 76,795,763 L14984* probably null Het
Tyr T C 7: 87,483,884 T325A probably benign Het
U2surp A T 9: 95,485,679 probably null Het
Uba6 C A 5: 86,147,075 K368N probably benign Het
Upb1 A G 10: 75,436,201 T283A probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r31 A G 6: 58,472,470 Y137H probably damaging Het
Wdtc1 T C 4: 133,296,437 K541R probably damaging Het
Wrn A G 8: 33,310,713 I624T possibly damaging Het
Zfp804b T A 5: 6,770,066 D999V possibly damaging Het
Zmym4 T A 4: 126,925,795 H105L probably benign Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0715:Phf3 UTSW 1 30811838 missense probably damaging 1.00
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2497:Phf3 UTSW 1 30830014 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5823:Phf3 UTSW 1 30804683 missense probably damaging 1.00
R5944:Phf3 UTSW 1 30820704 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30837158 missense probably damaging 0.96
R7549:Phf3 UTSW 1 30831475 missense probably benign 0.01
R7720:Phf3 UTSW 1 30829857 missense probably damaging 1.00
R7745:Phf3 UTSW 1 30804224 missense probably damaging 1.00
R8134:Phf3 UTSW 1 30824471 missense unknown
R8264:Phf3 UTSW 1 30831057 missense possibly damaging 0.48
Z1177:Phf3 UTSW 1 30804295 missense probably damaging 1.00
Z1177:Phf3 UTSW 1 30805051 missense unknown
Z1177:Phf3 UTSW 1 30811968 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGACTGAGACTTGCCAAAGG -3'
(R):5'- AGCTGAACCTCTGATGGAAGTC -3'

Sequencing Primer
(F):5'- GATGAACCTACCGATGAAGTCTCTTC -3'
(R):5'- TCTGATGGAAGTCACCAAGC -3'
Posted On2019-10-24