Incidental Mutation 'R7609:Pde4dip'
ID588470
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7609 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 97715565 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1443 (V1443F)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090750
AA Change: V1443F

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: V1443F

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168438
AA Change: V1443F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: V1443F

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,989,460 Y288C probably benign Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Agl C A 3: 116,807,279 R24I possibly damaging Het
Aldoart2 A G 12: 55,566,048 T253A probably benign Het
Ankrd39 G A 1: 36,539,465 R160W probably damaging Het
Aspscr1 C T 11: 120,677,522 T57M probably damaging Het
Baz2b A G 2: 59,962,473 L437S probably benign Het
Bcl9l T A 9: 44,505,747 L331Q probably damaging Het
Cdhr4 C A 9: 107,997,283 P546T probably damaging Het
Cfap61 T C 2: 146,112,533 C231R unknown Het
Cnih4 T C 1: 181,155,902 L61P probably damaging Het
Dtx4 A G 19: 12,492,281 Y161H probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ercc6 A G 14: 32,566,361 H830R probably benign Het
Exoc7 T C 11: 116,289,259 N673S possibly damaging Het
Gm12185 T C 11: 48,916,023 S114G possibly damaging Het
Hsfy2 A T 1: 56,637,151 F76I probably benign Het
Igsf9b A G 9: 27,345,890 D1413G probably benign Het
Klk8 G A 7: 43,802,179 C198Y probably damaging Het
Lama3 G T 18: 12,531,834 probably null Het
Lce3f A T 3: 92,993,096 S75C unknown Het
Ldhal6b T C 17: 5,417,991 M223V probably benign Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
Mc1r A T 8: 123,408,293 I262F probably damaging Het
Mecom A G 3: 29,956,442 I629T probably damaging Het
Mkrn2os A G 6: 115,586,726 V116A possibly damaging Het
Muc5b T A 7: 141,861,729 V2804D possibly damaging Het
Myo15 T C 11: 60,488,811 V279A Het
Nhlrc2 A G 19: 56,594,896 I600V probably benign Het
Nipbl T C 15: 8,305,872 Q2183R probably benign Het
Obscn C T 11: 59,000,299 E7136K unknown Het
Olfr1118 T C 2: 87,309,509 V260A probably benign Het
Olfr25 A C 9: 38,330,224 L209F possibly damaging Het
Olfr481 T A 7: 108,081,546 F251I probably damaging Het
Olfr970 C T 9: 39,820,287 T216I probably benign Het
Otop3 T C 11: 115,339,720 I141T possibly damaging Het
Pdgfra T C 5: 75,166,721 V193A probably benign Het
Phf3 T C 1: 30,805,501 Y1459C probably benign Het
Pias4 A T 10: 81,158,026 probably null Het
Plcg2 A G 8: 117,558,113 N159S probably benign Het
Plekha7 T C 7: 116,164,446 D307G probably benign Het
Ptprd T C 4: 76,072,003 K491E probably benign Het
Rbpjl A T 2: 164,405,814 R62S probably benign Het
Rgs11 T C 17: 26,207,441 S245P probably damaging Het
Ripor3 G A 2: 167,984,570 A685V possibly damaging Het
Rnase9 G A 14: 51,039,483 P13S possibly damaging Het
Scin C T 12: 40,124,589 C165Y probably damaging Het
Senp7 T C 16: 56,111,637 W100R probably benign Het
Slc26a2 T C 18: 61,198,460 D633G probably benign Het
Slc4a4 C T 5: 89,135,686 P446S probably damaging Het
Soga3 A T 10: 29,148,228 D380V probably damaging Het
Spag17 T A 3: 100,095,595 C1878* probably null Het
Ssc5d A G 7: 4,927,576 E129G possibly damaging Het
Supt6 T C 11: 78,226,951 N480D probably benign Het
Tbk1 A G 10: 121,552,501 L590S probably damaging Het
Tex45 A T 8: 3,476,057 H70L probably benign Het
Tmem63a T A 1: 180,952,974 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A G 15: 27,912,642 S109P unknown Het
Tsga10 A T 1: 37,804,893 probably null Het
Ttn A T 2: 76,795,763 L14984* probably null Het
Tyr T C 7: 87,483,884 T325A probably benign Het
U2surp A T 9: 95,485,679 probably null Het
Uba6 C A 5: 86,147,075 K368N probably benign Het
Upb1 A G 10: 75,436,201 T283A probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r31 A G 6: 58,472,470 Y137H probably damaging Het
Wdtc1 T C 4: 133,296,437 K541R probably damaging Het
Wrn A G 8: 33,310,713 I624T possibly damaging Het
Zfp804b T A 5: 6,770,066 D999V possibly damaging Het
Zmym4 T A 4: 126,925,795 H105L probably benign Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGTCGCTTGTGGCAGACAG -3'
(R):5'- AAAGGAAGCACTGCTCTGG -3'

Sequencing Primer
(F):5'- TTGTGGCAGACAGGGACC -3'
(R):5'- GAAGCACTGCTCTGGGTTTTATCC -3'
Posted On2019-10-24