Mutagenetix > Incidental Mutations

Incidental Mutation 'R7609:Slc4a4'

588481

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7609 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89135686 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 446 (P446S)

Ref Sequence

ENSEMBL: ENSMUSP00000108844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]

Predicted Effect

probably damaging
Transcript: ENSMUST00000113218
AA Change: P446S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: P446S

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000130041
AA Change: P411S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: P411S

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000148750
AA Change: P455S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: P455S

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156238
AA Change: P455S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: P455S

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,989,460	Y288C	probably benign	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Agl	C	A	3: 116,807,279	R24I	possibly damaging	Het
Aldoart2	A	G	12: 55,566,048	T253A	probably benign	Het
Ankrd39	G	A	1: 36,539,465	R160W	probably damaging	Het
Aspscr1	C	T	11: 120,677,522	T57M	probably damaging	Het
Baz2b	A	G	2: 59,962,473	L437S	probably benign	Het
Bcl9l	T	A	9: 44,505,747	L331Q	probably damaging	Het
Cdhr4	C	A	9: 107,997,283	P546T	probably damaging	Het
Cfap61	T	C	2: 146,112,533	C231R	unknown	Het
Cnih4	T	C	1: 181,155,902	L61P	probably damaging	Het
Dtx4	A	G	19: 12,492,281	Y161H	probably damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ercc6	A	G	14: 32,566,361	H830R	probably benign	Het
Exoc7	T	C	11: 116,289,259	N673S	possibly damaging	Het
Gm12185	T	C	11: 48,916,023	S114G	possibly damaging	Het
Hsfy2	A	T	1: 56,637,151	F76I	probably benign	Het
Igsf9b	A	G	9: 27,345,890	D1413G	probably benign	Het
Klk8	G	A	7: 43,802,179	C198Y	probably damaging	Het
Lama3	G	T	18: 12,531,834		probably null	Het
Lce3f	A	T	3: 92,993,096	S75C	unknown	Het
Ldhal6b	T	C	17: 5,417,991	M223V	probably benign	Het
Magoh	T	C	4: 107,887,212	V126A	possibly damaging	Het
Mc1r	A	T	8: 123,408,293	I262F	probably damaging	Het
Mecom	A	G	3: 29,956,442	I629T	probably damaging	Het
Mkrn2os	A	G	6: 115,586,726	V116A	possibly damaging	Het
Muc5b	T	A	7: 141,861,729	V2804D	possibly damaging	Het
Myo15	T	C	11: 60,488,811	V279A		Het
Nhlrc2	A	G	19: 56,594,896	I600V	probably benign	Het
Nipbl	T	C	15: 8,305,872	Q2183R	probably benign	Het
Obscn	C	T	11: 59,000,299	E7136K	unknown	Het
Olfr1118	T	C	2: 87,309,509	V260A	probably benign	Het
Olfr25	A	C	9: 38,330,224	L209F	possibly damaging	Het
Olfr481	T	A	7: 108,081,546	F251I	probably damaging	Het
Olfr970	C	T	9: 39,820,287	T216I	probably benign	Het
Otop3	T	C	11: 115,339,720	I141T	possibly damaging	Het
Pde4dip	C	A	3: 97,715,565	V1443F	possibly damaging	Het
Pdgfra	T	C	5: 75,166,721	V193A	probably benign	Het
Phf3	T	C	1: 30,805,501	Y1459C	probably benign	Het
Pias4	A	T	10: 81,158,026		probably null	Het
Plcg2	A	G	8: 117,558,113	N159S	probably benign	Het
Plekha7	T	C	7: 116,164,446	D307G	probably benign	Het
Ptprd	T	C	4: 76,072,003	K491E	probably benign	Het
Rbpjl	A	T	2: 164,405,814	R62S	probably benign	Het
Rgs11	T	C	17: 26,207,441	S245P	probably damaging	Het
Ripor3	G	A	2: 167,984,570	A685V	possibly damaging	Het
Rnase9	G	A	14: 51,039,483	P13S	possibly damaging	Het
Scin	C	T	12: 40,124,589	C165Y	probably damaging	Het
Senp7	T	C	16: 56,111,637	W100R	probably benign	Het
Slc26a2	T	C	18: 61,198,460	D633G	probably benign	Het
Soga3	A	T	10: 29,148,228	D380V	probably damaging	Het
Spag17	T	A	3: 100,095,595	C1878*	probably null	Het
Ssc5d	A	G	7: 4,927,576	E129G	possibly damaging	Het
Supt6	T	C	11: 78,226,951	N480D	probably benign	Het
Tbk1	A	G	10: 121,552,501	L590S	probably damaging	Het
Tex45	A	T	8: 3,476,057	H70L	probably benign	Het
Tmem63a	T	A	1: 180,952,974		probably null	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Trio	A	G	15: 27,912,642	S109P	unknown	Het
Tsga10	A	T	1: 37,804,893		probably null	Het
Ttn	A	T	2: 76,795,763	L14984*	probably null	Het
Tyr	T	C	7: 87,483,884	T325A	probably benign	Het
U2surp	A	T	9: 95,485,679		probably null	Het
Uba6	C	A	5: 86,147,075	K368N	probably benign	Het
Upb1	A	G	10: 75,436,201	T283A	probably benign	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn1r31	A	G	6: 58,472,470	Y137H	probably damaging	Het
Wdtc1	T	C	4: 133,296,437	K541R	probably damaging	Het
Wrn	A	G	8: 33,310,713	I624T	possibly damaging	Het
Zfp804b	T	A	5: 6,770,066	D999V	possibly damaging	Het
Zmym4	T	A	4: 126,925,795	H105L	probably benign	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78
R7931:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
R8534:Slc4a4	UTSW	5	89135722	missense	probably damaging	1.00
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCTCATCTAAACGAGAAGGTC -3'
(R):5'- GTAACTGAAGGGCCATCTGC -3'

Sequencing Primer
(F):5'- ACGAGAAGGTCTTAAATAGTATCTGG -3'
(R):5'- GACAGTCTGCGCTGGACTATTTG -3'

Posted On

2019-10-24