Incidental Mutation 'R7609:Tbk1'
ID588502
Institutional Source Beutler Lab
Gene Symbol Tbk1
Ensembl Gene ENSMUSG00000020115
Gene NameTANK-binding kinase 1
Synonyms1200008B05Rik
MMRRC Submission
Accession Numbers

MGI: 1929658

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7609 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location121546455-121586787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121552501 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 590 (L590S)
Ref Sequence ENSEMBL: ENSMUSP00000020316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020316] [ENSMUST00000219400]
PDB Structure
Crystal structure of mouse TBK1 bound to BX795 [X-RAY DIFFRACTION]
Crystal structure of mouse TBK1 bound to SU6668 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020316
AA Change: L590S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020316
Gene: ENSMUSG00000020115
AA Change: L590S

DomainStartEndE-ValueType
Pfam:Pkinase 9 300 2.6e-46 PFAM
Pfam:Pkinase_Tyr 10 250 1.5e-27 PFAM
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219400
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(5) Gene trapped(18)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,989,460 Y288C probably benign Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Agl C A 3: 116,807,279 R24I possibly damaging Het
Aldoart2 A G 12: 55,566,048 T253A probably benign Het
Ankrd39 G A 1: 36,539,465 R160W probably damaging Het
Aspscr1 C T 11: 120,677,522 T57M probably damaging Het
Baz2b A G 2: 59,962,473 L437S probably benign Het
Bcl9l T A 9: 44,505,747 L331Q probably damaging Het
Cdhr4 C A 9: 107,997,283 P546T probably damaging Het
Cfap61 T C 2: 146,112,533 C231R unknown Het
Cnih4 T C 1: 181,155,902 L61P probably damaging Het
Dtx4 A G 19: 12,492,281 Y161H probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ercc6 A G 14: 32,566,361 H830R probably benign Het
Exoc7 T C 11: 116,289,259 N673S possibly damaging Het
Gm12185 T C 11: 48,916,023 S114G possibly damaging Het
Hsfy2 A T 1: 56,637,151 F76I probably benign Het
Igsf9b A G 9: 27,345,890 D1413G probably benign Het
Klk8 G A 7: 43,802,179 C198Y probably damaging Het
Lama3 G T 18: 12,531,834 probably null Het
Lce3f A T 3: 92,993,096 S75C unknown Het
Ldhal6b T C 17: 5,417,991 M223V probably benign Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
Mc1r A T 8: 123,408,293 I262F probably damaging Het
Mecom A G 3: 29,956,442 I629T probably damaging Het
Mkrn2os A G 6: 115,586,726 V116A possibly damaging Het
Muc5b T A 7: 141,861,729 V2804D possibly damaging Het
Myo15 T C 11: 60,488,811 V279A Het
Nhlrc2 A G 19: 56,594,896 I600V probably benign Het
Nipbl T C 15: 8,305,872 Q2183R probably benign Het
Obscn C T 11: 59,000,299 E7136K unknown Het
Olfr1118 T C 2: 87,309,509 V260A probably benign Het
Olfr25 A C 9: 38,330,224 L209F possibly damaging Het
Olfr481 T A 7: 108,081,546 F251I probably damaging Het
Olfr970 C T 9: 39,820,287 T216I probably benign Het
Otop3 T C 11: 115,339,720 I141T possibly damaging Het
Pde4dip C A 3: 97,715,565 V1443F possibly damaging Het
Pdgfra T C 5: 75,166,721 V193A probably benign Het
Phf3 T C 1: 30,805,501 Y1459C probably benign Het
Pias4 A T 10: 81,158,026 probably null Het
Plcg2 A G 8: 117,558,113 N159S probably benign Het
Plekha7 T C 7: 116,164,446 D307G probably benign Het
Ptprd T C 4: 76,072,003 K491E probably benign Het
Rbpjl A T 2: 164,405,814 R62S probably benign Het
Rgs11 T C 17: 26,207,441 S245P probably damaging Het
Ripor3 G A 2: 167,984,570 A685V possibly damaging Het
Rnase9 G A 14: 51,039,483 P13S possibly damaging Het
Scin C T 12: 40,124,589 C165Y probably damaging Het
Senp7 T C 16: 56,111,637 W100R probably benign Het
Slc26a2 T C 18: 61,198,460 D633G probably benign Het
Slc4a4 C T 5: 89,135,686 P446S probably damaging Het
Soga3 A T 10: 29,148,228 D380V probably damaging Het
Spag17 T A 3: 100,095,595 C1878* probably null Het
Ssc5d A G 7: 4,927,576 E129G possibly damaging Het
Supt6 T C 11: 78,226,951 N480D probably benign Het
Tex45 A T 8: 3,476,057 H70L probably benign Het
Tmem63a T A 1: 180,952,974 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A G 15: 27,912,642 S109P unknown Het
Tsga10 A T 1: 37,804,893 probably null Het
Ttn A T 2: 76,795,763 L14984* probably null Het
Tyr T C 7: 87,483,884 T325A probably benign Het
U2surp A T 9: 95,485,679 probably null Het
Uba6 C A 5: 86,147,075 K368N probably benign Het
Upb1 A G 10: 75,436,201 T283A probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r31 A G 6: 58,472,470 Y137H probably damaging Het
Wdtc1 T C 4: 133,296,437 K541R probably damaging Het
Wrn A G 8: 33,310,713 I624T possibly damaging Het
Zfp804b T A 5: 6,770,066 D999V possibly damaging Het
Zmym4 T A 4: 126,925,795 H105L probably benign Het
Other mutations in Tbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tbk1 APN 10 121552250 missense probably benign 0.00
IGL01021:Tbk1 APN 10 121551272 missense probably benign 0.07
IGL01371:Tbk1 APN 10 121559871 missense probably benign 0.09
IGL01383:Tbk1 APN 10 121576279 missense probably damaging 1.00
IGL01583:Tbk1 APN 10 121557229 missense probably benign
IGL01734:Tbk1 APN 10 121571983 nonsense probably null
IGL02068:Tbk1 APN 10 121570789 missense probably damaging 1.00
IGL02676:Tbk1 APN 10 121568080 missense possibly damaging 0.82
IGL02737:Tbk1 APN 10 121559862 missense probably null 0.96
IGL03334:Tbk1 APN 10 121584199 missense possibly damaging 0.79
Pathfinder UTSW 10 121552501 missense probably damaging 0.98
pioneer UTSW 10 121578690 missense probably damaging 1.00
trailblazer UTSW 10 121570685 missense probably damaging 1.00
BB006:Tbk1 UTSW 10 121557233 missense probably benign 0.00
BB016:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R0030:Tbk1 UTSW 10 121561624 missense probably benign 0.09
R0386:Tbk1 UTSW 10 121584254 missense probably damaging 0.96
R1396:Tbk1 UTSW 10 121571916 missense probably damaging 1.00
R1430:Tbk1 UTSW 10 121559934 missense probably benign
R1522:Tbk1 UTSW 10 121551318 missense probably benign 0.06
R1542:Tbk1 UTSW 10 121559935 missense probably benign
R1717:Tbk1 UTSW 10 121561645 missense probably benign 0.10
R1860:Tbk1 UTSW 10 121547171 missense probably benign 0.01
R2188:Tbk1 UTSW 10 121563931 nonsense probably null
R2519:Tbk1 UTSW 10 121557259 missense probably benign 0.03
R4627:Tbk1 UTSW 10 121568080 missense possibly damaging 0.82
R4945:Tbk1 UTSW 10 121551269 missense probably damaging 0.98
R5061:Tbk1 UTSW 10 121576336 missense possibly damaging 0.62
R5256:Tbk1 UTSW 10 121570685 missense probably damaging 1.00
R5310:Tbk1 UTSW 10 121556051 missense probably benign 0.00
R6187:Tbk1 UTSW 10 121584243 missense probably benign 0.02
R6425:Tbk1 UTSW 10 121563962 missense probably benign 0.00
R6512:Tbk1 UTSW 10 121578621 missense probably damaging 1.00
R6897:Tbk1 UTSW 10 121559877 missense probably benign 0.00
R7268:Tbk1 UTSW 10 121552499 missense probably benign 0.03
R7860:Tbk1 UTSW 10 121552246 missense possibly damaging 0.55
R7929:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R8378:Tbk1 UTSW 10 121578692 missense probably damaging 0.96
X0022:Tbk1 UTSW 10 121560293 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCCTGGAAACTCACTCAGAG -3'
(R):5'- ACCTCTGCTGTGCTTACAGG -3'

Sequencing Primer
(F):5'- CTCACTCAGAGTACACAGCACACTG -3'
(R):5'- TTACAGGGGGCATCCGATG -3'
Posted On2019-10-24