Incidental Mutation 'R7609:Otop3'
ID588507
Institutional Source Beutler Lab
Gene Symbol Otop3
Ensembl Gene ENSMUSG00000018862
Gene Nameotopetrin 3
Synonyms2310011E08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7609 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115334731-115346927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115339720 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 141 (I141T)
Ref Sequence ENSEMBL: ENSMUSP00000102153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000106543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019006
AA Change: I141T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862
AA Change: I141T

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106543
AA Change: I141T

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862
AA Change: I141T

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,989,460 Y288C probably benign Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Agl C A 3: 116,807,279 R24I possibly damaging Het
Aldoart2 A G 12: 55,566,048 T253A probably benign Het
Ankrd39 G A 1: 36,539,465 R160W probably damaging Het
Aspscr1 C T 11: 120,677,522 T57M probably damaging Het
Baz2b A G 2: 59,962,473 L437S probably benign Het
Bcl9l T A 9: 44,505,747 L331Q probably damaging Het
Cdhr4 C A 9: 107,997,283 P546T probably damaging Het
Cfap61 T C 2: 146,112,533 C231R unknown Het
Cnih4 T C 1: 181,155,902 L61P probably damaging Het
Dtx4 A G 19: 12,492,281 Y161H probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ercc6 A G 14: 32,566,361 H830R probably benign Het
Exoc7 T C 11: 116,289,259 N673S possibly damaging Het
Gm12185 T C 11: 48,916,023 S114G possibly damaging Het
Hsfy2 A T 1: 56,637,151 F76I probably benign Het
Igsf9b A G 9: 27,345,890 D1413G probably benign Het
Klk8 G A 7: 43,802,179 C198Y probably damaging Het
Lama3 G T 18: 12,531,834 probably null Het
Lce3f A T 3: 92,993,096 S75C unknown Het
Ldhal6b T C 17: 5,417,991 M223V probably benign Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
Mc1r A T 8: 123,408,293 I262F probably damaging Het
Mecom A G 3: 29,956,442 I629T probably damaging Het
Mkrn2os A G 6: 115,586,726 V116A possibly damaging Het
Muc5b T A 7: 141,861,729 V2804D possibly damaging Het
Myo15 T C 11: 60,488,811 V279A Het
Nhlrc2 A G 19: 56,594,896 I600V probably benign Het
Nipbl T C 15: 8,305,872 Q2183R probably benign Het
Obscn C T 11: 59,000,299 E7136K unknown Het
Olfr1118 T C 2: 87,309,509 V260A probably benign Het
Olfr25 A C 9: 38,330,224 L209F possibly damaging Het
Olfr481 T A 7: 108,081,546 F251I probably damaging Het
Olfr970 C T 9: 39,820,287 T216I probably benign Het
Pde4dip C A 3: 97,715,565 V1443F possibly damaging Het
Pdgfra T C 5: 75,166,721 V193A probably benign Het
Phf3 T C 1: 30,805,501 Y1459C probably benign Het
Plcg2 A G 8: 117,558,113 N159S probably benign Het
Plekha7 T C 7: 116,164,446 D307G probably benign Het
Ptprd T C 4: 76,072,003 K491E probably benign Het
Rbpjl A T 2: 164,405,814 R62S probably benign Het
Rgs11 T C 17: 26,207,441 S245P probably damaging Het
Ripor3 G A 2: 167,984,570 A685V possibly damaging Het
Rnase9 G A 14: 51,039,483 P13S possibly damaging Het
Scin C T 12: 40,124,589 C165Y probably damaging Het
Senp7 T C 16: 56,111,637 W100R probably benign Het
Slc26a2 T C 18: 61,198,460 D633G probably benign Het
Slc4a4 C T 5: 89,135,686 P446S probably damaging Het
Soga3 A T 10: 29,148,228 D380V probably damaging Het
Spag17 T A 3: 100,095,595 C1878* probably null Het
Ssc5d A G 7: 4,927,576 E129G possibly damaging Het
Supt6 T C 11: 78,226,951 N480D probably benign Het
Tbk1 A G 10: 121,552,501 L590S probably damaging Het
Tex45 A T 8: 3,476,057 H70L probably benign Het
Tmem63a T A 1: 180,952,974 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A G 15: 27,912,642 S109P unknown Het
Ttn A T 2: 76,795,763 L14984* probably null Het
Tyr T C 7: 87,483,884 T325A probably benign Het
Uba6 C A 5: 86,147,075 K368N probably benign Het
Upb1 A G 10: 75,436,201 T283A probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r31 A G 6: 58,472,470 Y137H probably damaging Het
Wdtc1 T C 4: 133,296,437 K541R probably damaging Het
Wrn A G 8: 33,310,713 I624T possibly damaging Het
Zfp804b T A 5: 6,770,066 D999V possibly damaging Het
Zmym4 T A 4: 126,925,795 H105L probably benign Het
Other mutations in Otop3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Otop3 APN 11 115344453 missense probably benign
IGL00159:Otop3 APN 11 115344397 missense probably damaging 1.00
IGL01372:Otop3 APN 11 115345104 missense possibly damaging 0.86
IGL01380:Otop3 APN 11 115346411 missense probably damaging 1.00
IGL01960:Otop3 APN 11 115340969 missense probably damaging 0.97
IGL03099:Otop3 APN 11 115339582 missense probably damaging 0.99
F5770:Otop3 UTSW 11 115344838 missense probably damaging 1.00
R1560:Otop3 UTSW 11 115344463 missense possibly damaging 0.89
R2847:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R2849:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R5582:Otop3 UTSW 11 115339339 missense unknown
R6383:Otop3 UTSW 11 115345072 missense probably damaging 0.99
R6601:Otop3 UTSW 11 115339847 missense probably damaging 0.98
R7001:Otop3 UTSW 11 115339653 missense probably damaging 1.00
R7339:Otop3 UTSW 11 115346378 missense probably damaging 1.00
R7487:Otop3 UTSW 11 115345000 missense probably benign
R7639:Otop3 UTSW 11 115344361 missense possibly damaging 0.94
R7643:Otop3 UTSW 11 115339648 missense probably damaging 1.00
R7820:Otop3 UTSW 11 115339588 missense probably damaging 0.99
V7580:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7581:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7582:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7583:Otop3 UTSW 11 115344838 missense probably damaging 1.00
X0022:Otop3 UTSW 11 115339867 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTCTCAATGTGGTATTCC -3'
(R):5'- GACTTGCAGTGAATGTGGCTC -3'

Sequencing Primer
(F):5'- CTCTCAATGTGGTATTCCTGGGTG -3'
(R):5'- GTGAATGTGGCTCACGTCATAACC -3'
Posted On2019-10-24