Incidental Mutation 'R7609:Scin'
ID588510
Institutional Source Beutler Lab
Gene Symbol Scin
Ensembl Gene ENSMUSG00000002565
Gene Namescinderin
Synonymsadseverin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7609 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location40059769-40134228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40124589 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 165 (C165Y)
Ref Sequence ENSEMBL: ENSMUSP00000002640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]
Predicted Effect probably damaging
Transcript: ENSMUST00000002640
AA Change: C165Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565
AA Change: C165Y

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 596 2.33e-23 SMART
GEL 615 710 2.07e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078481
AA Change: C165Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565
AA Change: C165Y

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 610 1.09e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,989,460 Y288C probably benign Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Agl C A 3: 116,807,279 R24I possibly damaging Het
Aldoart2 A G 12: 55,566,048 T253A probably benign Het
Ankrd39 G A 1: 36,539,465 R160W probably damaging Het
Aspscr1 C T 11: 120,677,522 T57M probably damaging Het
Baz2b A G 2: 59,962,473 L437S probably benign Het
Bcl9l T A 9: 44,505,747 L331Q probably damaging Het
Cdhr4 C A 9: 107,997,283 P546T probably damaging Het
Cfap61 T C 2: 146,112,533 C231R unknown Het
Cnih4 T C 1: 181,155,902 L61P probably damaging Het
Dtx4 A G 19: 12,492,281 Y161H probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ercc6 A G 14: 32,566,361 H830R probably benign Het
Exoc7 T C 11: 116,289,259 N673S possibly damaging Het
Gm12185 T C 11: 48,916,023 S114G possibly damaging Het
Hsfy2 A T 1: 56,637,151 F76I probably benign Het
Igsf9b A G 9: 27,345,890 D1413G probably benign Het
Klk8 G A 7: 43,802,179 C198Y probably damaging Het
Lama3 G T 18: 12,531,834 probably null Het
Lce3f A T 3: 92,993,096 S75C unknown Het
Ldhal6b T C 17: 5,417,991 M223V probably benign Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
Mc1r A T 8: 123,408,293 I262F probably damaging Het
Mecom A G 3: 29,956,442 I629T probably damaging Het
Mkrn2os A G 6: 115,586,726 V116A possibly damaging Het
Muc5b T A 7: 141,861,729 V2804D possibly damaging Het
Myo15 T C 11: 60,488,811 V279A Het
Nhlrc2 A G 19: 56,594,896 I600V probably benign Het
Nipbl T C 15: 8,305,872 Q2183R probably benign Het
Obscn C T 11: 59,000,299 E7136K unknown Het
Olfr1118 T C 2: 87,309,509 V260A probably benign Het
Olfr25 A C 9: 38,330,224 L209F possibly damaging Het
Olfr481 T A 7: 108,081,546 F251I probably damaging Het
Olfr970 C T 9: 39,820,287 T216I probably benign Het
Otop3 T C 11: 115,339,720 I141T possibly damaging Het
Pde4dip C A 3: 97,715,565 V1443F possibly damaging Het
Pdgfra T C 5: 75,166,721 V193A probably benign Het
Phf3 T C 1: 30,805,501 Y1459C probably benign Het
Plcg2 A G 8: 117,558,113 N159S probably benign Het
Plekha7 T C 7: 116,164,446 D307G probably benign Het
Ptprd T C 4: 76,072,003 K491E probably benign Het
Rbpjl A T 2: 164,405,814 R62S probably benign Het
Rgs11 T C 17: 26,207,441 S245P probably damaging Het
Ripor3 G A 2: 167,984,570 A685V possibly damaging Het
Rnase9 G A 14: 51,039,483 P13S possibly damaging Het
Senp7 T C 16: 56,111,637 W100R probably benign Het
Slc26a2 T C 18: 61,198,460 D633G probably benign Het
Slc4a4 C T 5: 89,135,686 P446S probably damaging Het
Soga3 A T 10: 29,148,228 D380V probably damaging Het
Spag17 T A 3: 100,095,595 C1878* probably null Het
Ssc5d A G 7: 4,927,576 E129G possibly damaging Het
Supt6 T C 11: 78,226,951 N480D probably benign Het
Tbk1 A G 10: 121,552,501 L590S probably damaging Het
Tex45 A T 8: 3,476,057 H70L probably benign Het
Tmem63a T A 1: 180,952,974 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A G 15: 27,912,642 S109P unknown Het
Ttn A T 2: 76,795,763 L14984* probably null Het
Tyr T C 7: 87,483,884 T325A probably benign Het
Uba6 C A 5: 86,147,075 K368N probably benign Het
Upb1 A G 10: 75,436,201 T283A probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r31 A G 6: 58,472,470 Y137H probably damaging Het
Wdtc1 T C 4: 133,296,437 K541R probably damaging Het
Wrn A G 8: 33,310,713 I624T possibly damaging Het
Zfp804b T A 5: 6,770,066 D999V possibly damaging Het
Zmym4 T A 4: 126,925,795 H105L probably benign Het
Other mutations in Scin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Scin APN 12 40076972 missense probably benign 0.03
IGL01414:Scin APN 12 40124699 missense probably damaging 1.00
IGL01790:Scin APN 12 40063257 missense probably benign 0.02
IGL01807:Scin APN 12 40084289 missense probably damaging 1.00
IGL01946:Scin APN 12 40060491 utr 3 prime probably benign
IGL02040:Scin APN 12 40069453 intron probably benign
IGL02391:Scin APN 12 40077531 missense probably benign 0.05
IGL03221:Scin APN 12 40076974 missense probably benign 0.01
I1329:Scin UTSW 12 40073330 missense probably damaging 0.99
PIT4498001:Scin UTSW 12 40069447 critical splice acceptor site probably null
R0108:Scin UTSW 12 40127987 missense possibly damaging 0.68
R0470:Scin UTSW 12 40073292 splice site probably benign
R0477:Scin UTSW 12 40060516 missense probably damaging 1.00
R0538:Scin UTSW 12 40081771 missense probably damaging 0.98
R0539:Scin UTSW 12 40081766 missense possibly damaging 0.65
R0591:Scin UTSW 12 40080930 critical splice donor site probably null
R0668:Scin UTSW 12 40080949 missense probably damaging 1.00
R0718:Scin UTSW 12 40079607 missense probably damaging 1.00
R1473:Scin UTSW 12 40077502 missense probably benign
R1566:Scin UTSW 12 40081674 missense probably benign 0.17
R1570:Scin UTSW 12 40084381 splice site probably benign
R1624:Scin UTSW 12 40127930 missense probably benign
R1827:Scin UTSW 12 40068923 missense possibly damaging 0.88
R1836:Scin UTSW 12 40124698 missense probably damaging 1.00
R1985:Scin UTSW 12 40133908 critical splice donor site probably null
R2042:Scin UTSW 12 40077510 missense possibly damaging 0.96
R2061:Scin UTSW 12 40080948 missense probably damaging 1.00
R2147:Scin UTSW 12 40080985 missense probably benign 0.00
R2232:Scin UTSW 12 40068931 missense probably damaging 1.00
R2504:Scin UTSW 12 40081706 missense probably benign 0.02
R4781:Scin UTSW 12 40081764 missense possibly damaging 0.59
R4898:Scin UTSW 12 40104932 missense probably benign
R4914:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4915:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4916:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4917:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4918:Scin UTSW 12 40069374 missense possibly damaging 0.79
R5068:Scin UTSW 12 40124700 missense probably damaging 1.00
R5098:Scin UTSW 12 40077542 nonsense probably null
R5233:Scin UTSW 12 40077559 missense probably benign
R5564:Scin UTSW 12 40124569 missense probably benign
R5677:Scin UTSW 12 40063259 missense probably damaging 1.00
R5967:Scin UTSW 12 40077538 missense probably benign 0.35
R6027:Scin UTSW 12 40077516 missense probably damaging 1.00
R6130:Scin UTSW 12 40069436 missense probably benign 0.01
R6134:Scin UTSW 12 40060579 missense probably damaging 1.00
R6135:Scin UTSW 12 40079808 missense possibly damaging 0.80
R6439:Scin UTSW 12 40068946 missense probably damaging 0.99
R6613:Scin UTSW 12 40079715 missense probably benign 0.04
R7127:Scin UTSW 12 40105072 missense possibly damaging 0.69
R7234:Scin UTSW 12 40080958 nonsense probably null
R7431:Scin UTSW 12 40133922 missense probably damaging 1.00
R7665:Scin UTSW 12 40069415 missense probably damaging 1.00
R7704:Scin UTSW 12 40124688 missense possibly damaging 0.93
R7904:Scin UTSW 12 40077000 missense probably damaging 1.00
R7987:Scin UTSW 12 40077000 missense probably damaging 1.00
R7995:Scin UTSW 12 40079805 missense not run
X0018:Scin UTSW 12 40069433 missense probably damaging 1.00
Z1176:Scin UTSW 12 40079604 missense not run
Predicted Primers PCR Primer
(F):5'- ATCAGCGGAAACTCTGTCCAG -3'
(R):5'- TGTGTCTGGGTAGCAGTCTCAC -3'

Sequencing Primer
(F):5'- TCTGTCCAGAGTCATGAGGAAATCC -3'
(R):5'- GGGTAGCAGTCTCACCTCTC -3'
Posted On2019-10-24