Incidental Mutation 'R7609:Senp7'
ID588516
Institutional Source Beutler Lab
Gene Symbol Senp7
Ensembl Gene ENSMUSG00000052917
Gene NameSUMO1/sentrin specific peptidase 7
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7609 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location56048338-56190012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56111637 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 100 (W100R)
Ref Sequence ENSEMBL: ENSMUSP00000086779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049128] [ENSMUST00000089360] [ENSMUST00000089362] [ENSMUST00000201011] [ENSMUST00000202000] [ENSMUST00000202799]
Predicted Effect probably damaging
Transcript: ENSMUST00000049128
AA Change: W100R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043023
Gene: ENSMUSG00000052917
AA Change: W100R

DomainStartEndE-ValueType
internal_repeat_1 86 118 1.08e-5 PROSPERO
internal_repeat_1 152 184 1.08e-5 PROSPERO
low complexity region 192 208 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089360
AA Change: W73R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000086776
Gene: ENSMUSG00000052917
AA Change: W73R

DomainStartEndE-ValueType
low complexity region 165 181 N/A INTRINSIC
low complexity region 352 376 N/A INTRINSIC
low complexity region 386 395 N/A INTRINSIC
low complexity region 639 646 N/A INTRINSIC
Pfam:Peptidase_C48 734 999 7.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089362
AA Change: W100R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000086779
Gene: ENSMUSG00000052917
AA Change: W100R

DomainStartEndE-ValueType
low complexity region 192 208 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 666 673 N/A INTRINSIC
Pfam:Peptidase_C48 761 1026 8.5e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000201011
AA Change: W73R

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000202000
AA Change: W100R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144116
Gene: ENSMUSG00000052917
AA Change: W100R

DomainStartEndE-ValueType
low complexity region 192 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202799
AA Change: W73R

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144348
Gene: ENSMUSG00000052917
AA Change: W73R

DomainStartEndE-ValueType
internal_repeat_1 59 91 2.07e-5 PROSPERO
internal_repeat_1 125 157 2.07e-5 PROSPERO
low complexity region 165 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a SUMO deconjugating enzyme of the Sentrin/SUMO-specific protease (SENP) family. The encoded protein is a protease that exhibits deSUMOylating activity towards proteins involved in chromatin remodeling and promotes chromatin relaxation for DNA repair or transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,989,460 Y288C probably benign Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Agl C A 3: 116,807,279 R24I possibly damaging Het
Aldoart2 A G 12: 55,566,048 T253A probably benign Het
Ankrd39 G A 1: 36,539,465 R160W probably damaging Het
Aspscr1 C T 11: 120,677,522 T57M probably damaging Het
Baz2b A G 2: 59,962,473 L437S probably benign Het
Bcl9l T A 9: 44,505,747 L331Q probably damaging Het
Cdhr4 C A 9: 107,997,283 P546T probably damaging Het
Cfap61 T C 2: 146,112,533 C231R unknown Het
Cnih4 T C 1: 181,155,902 L61P probably damaging Het
Dtx4 A G 19: 12,492,281 Y161H probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ercc6 A G 14: 32,566,361 H830R probably benign Het
Exoc7 T C 11: 116,289,259 N673S possibly damaging Het
Gm12185 T C 11: 48,916,023 S114G possibly damaging Het
Hsfy2 A T 1: 56,637,151 F76I probably benign Het
Igsf9b A G 9: 27,345,890 D1413G probably benign Het
Klk8 G A 7: 43,802,179 C198Y probably damaging Het
Lama3 G T 18: 12,531,834 probably null Het
Lce3f A T 3: 92,993,096 S75C unknown Het
Ldhal6b T C 17: 5,417,991 M223V probably benign Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
Mc1r A T 8: 123,408,293 I262F probably damaging Het
Mecom A G 3: 29,956,442 I629T probably damaging Het
Mkrn2os A G 6: 115,586,726 V116A possibly damaging Het
Muc5b T A 7: 141,861,729 V2804D possibly damaging Het
Myo15 T C 11: 60,488,811 V279A Het
Nhlrc2 A G 19: 56,594,896 I600V probably benign Het
Nipbl T C 15: 8,305,872 Q2183R probably benign Het
Obscn C T 11: 59,000,299 E7136K unknown Het
Olfr1118 T C 2: 87,309,509 V260A probably benign Het
Olfr25 A C 9: 38,330,224 L209F possibly damaging Het
Olfr481 T A 7: 108,081,546 F251I probably damaging Het
Olfr970 C T 9: 39,820,287 T216I probably benign Het
Otop3 T C 11: 115,339,720 I141T possibly damaging Het
Pde4dip C A 3: 97,715,565 V1443F possibly damaging Het
Pdgfra T C 5: 75,166,721 V193A probably benign Het
Phf3 T C 1: 30,805,501 Y1459C probably benign Het
Plcg2 A G 8: 117,558,113 N159S probably benign Het
Plekha7 T C 7: 116,164,446 D307G probably benign Het
Ptprd T C 4: 76,072,003 K491E probably benign Het
Rbpjl A T 2: 164,405,814 R62S probably benign Het
Rgs11 T C 17: 26,207,441 S245P probably damaging Het
Ripor3 G A 2: 167,984,570 A685V possibly damaging Het
Rnase9 G A 14: 51,039,483 P13S possibly damaging Het
Scin C T 12: 40,124,589 C165Y probably damaging Het
Slc26a2 T C 18: 61,198,460 D633G probably benign Het
Slc4a4 C T 5: 89,135,686 P446S probably damaging Het
Soga3 A T 10: 29,148,228 D380V probably damaging Het
Spag17 T A 3: 100,095,595 C1878* probably null Het
Ssc5d A G 7: 4,927,576 E129G possibly damaging Het
Supt6 T C 11: 78,226,951 N480D probably benign Het
Tbk1 A G 10: 121,552,501 L590S probably damaging Het
Tex45 A T 8: 3,476,057 H70L probably benign Het
Tmem63a T A 1: 180,952,974 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A G 15: 27,912,642 S109P unknown Het
Ttn A T 2: 76,795,763 L14984* probably null Het
Tyr T C 7: 87,483,884 T325A probably benign Het
Uba6 C A 5: 86,147,075 K368N probably benign Het
Upb1 A G 10: 75,436,201 T283A probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r31 A G 6: 58,472,470 Y137H probably damaging Het
Wdtc1 T C 4: 133,296,437 K541R probably damaging Het
Wrn A G 8: 33,310,713 I624T possibly damaging Het
Zfp804b T A 5: 6,770,066 D999V possibly damaging Het
Zmym4 T A 4: 126,925,795 H105L probably benign Het
Other mutations in Senp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Senp7 APN 16 56082377 missense probably damaging 0.96
IGL01610:Senp7 APN 16 56175823 missense possibly damaging 0.94
IGL01627:Senp7 APN 16 56171856 missense probably damaging 1.00
IGL02748:Senp7 APN 16 56186094 missense probably damaging 1.00
IGL03031:Senp7 APN 16 56175886 missense probably damaging 1.00
IGL03083:Senp7 APN 16 56171865 missense probably benign 0.28
R0034:Senp7 UTSW 16 56153570 missense possibly damaging 0.63
R0200:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0547:Senp7 UTSW 16 56175826 missense probably damaging 1.00
R0608:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R1595:Senp7 UTSW 16 56184768 missense probably damaging 1.00
R1737:Senp7 UTSW 16 56123799 missense probably damaging 1.00
R1837:Senp7 UTSW 16 56158516 missense probably benign 0.01
R1945:Senp7 UTSW 16 56123946 missense probably damaging 0.98
R2143:Senp7 UTSW 16 56169806 missense probably benign
R2275:Senp7 UTSW 16 56184783 missense probably damaging 1.00
R2508:Senp7 UTSW 16 56151362 missense probably benign 0.28
R3404:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3405:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3717:Senp7 UTSW 16 56179057 splice site probably benign
R3885:Senp7 UTSW 16 56186079 missense probably damaging 1.00
R4159:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4160:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4161:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4512:Senp7 UTSW 16 56165883 missense probably damaging 1.00
R5291:Senp7 UTSW 16 56186179 nonsense probably null
R5315:Senp7 UTSW 16 56180526 missense probably benign 0.26
R5390:Senp7 UTSW 16 56169916 missense probably benign
R5424:Senp7 UTSW 16 56186108 missense possibly damaging 0.82
R5643:Senp7 UTSW 16 56184149 splice site silent
R5644:Senp7 UTSW 16 56184149 splice site silent
R5645:Senp7 UTSW 16 56173208 missense possibly damaging 0.80
R5799:Senp7 UTSW 16 56139105 splice site probably null
R5860:Senp7 UTSW 16 56155359 missense possibly damaging 0.49
R5954:Senp7 UTSW 16 56169871 missense probably benign 0.04
R6164:Senp7 UTSW 16 56169754 missense probably damaging 1.00
R6280:Senp7 UTSW 16 56162375 missense possibly damaging 0.62
R6647:Senp7 UTSW 16 56173255 missense probably damaging 1.00
R6652:Senp7 UTSW 16 56123894 missense probably benign 0.08
R7310:Senp7 UTSW 16 56186082 missense probably benign 0.18
R7460:Senp7 UTSW 16 56173182 missense possibly damaging 0.65
R7480:Senp7 UTSW 16 56155226 missense possibly damaging 0.80
R7760:Senp7 UTSW 16 56139079 missense probably benign
U24488:Senp7 UTSW 16 56184819 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCCAATGTAAGTGAAGTAGGC -3'
(R):5'- ACACTATGTAACGTACCTTTCGG -3'

Sequencing Primer
(F):5'- CCCAATGTAAGTGAAGTAGGCTTTAC -3'
(R):5'- CGTACCTTTCGGATAAATTAAGGC -3'
Posted On2019-10-24