Incidental Mutation 'R7610:Olfr1104'
ID588532
Institutional Source Beutler Lab
Gene Symbol Olfr1104
Ensembl Gene ENSMUSG00000075166
Gene Nameolfactory receptor 1104
SynonymsGA_x6K02T2Q125-48508763-48507833, MOR207-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87020703-87027080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87021797 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000150156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099869] [ENSMUST00000214857] [ENSMUST00000215972]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099869
AA Change: V249A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097454
Gene: ENSMUSG00000075166
AA Change: V249A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 9.3e-48 PFAM
Pfam:7tm_1 41 289 2.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214857
AA Change: V249A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215972
AA Change: V249A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Olfr1104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1104 APN 2 87021884 missense probably damaging 1.00
IGL02533:Olfr1104 APN 2 87022353 missense probably damaging 1.00
IGL02662:Olfr1104 APN 2 87022002 missense probably benign 0.09
IGL02704:Olfr1104 APN 2 87022277 missense probably benign 0.00
R0145:Olfr1104 UTSW 2 87021790 nonsense probably null
R0625:Olfr1104 UTSW 2 87021620 missense probably benign
R1169:Olfr1104 UTSW 2 87021717 missense probably damaging 1.00
R1570:Olfr1104 UTSW 2 87022272 missense probably benign
R1727:Olfr1104 UTSW 2 87022263 missense probably damaging 1.00
R2146:Olfr1104 UTSW 2 87021665 missense probably damaging 1.00
R2192:Olfr1104 UTSW 2 87022511 missense probably benign 0.01
R3716:Olfr1104 UTSW 2 87022363 nonsense probably null
R3818:Olfr1104 UTSW 2 87021710 missense probably benign 0.02
R4711:Olfr1104 UTSW 2 87022026 missense probably damaging 1.00
R6104:Olfr1104 UTSW 2 87021713 missense probably damaging 1.00
R6482:Olfr1104 UTSW 2 87022525 missense probably benign 0.00
R7474:Olfr1104 UTSW 2 87022554 start gained probably benign
R7517:Olfr1104 UTSW 2 87022142 missense probably benign 0.45
R7944:Olfr1104 UTSW 2 87022313 missense probably benign 0.01
R7945:Olfr1104 UTSW 2 87022313 missense probably benign 0.01
R8235:Olfr1104 UTSW 2 87021882 missense probably benign 0.36
X0019:Olfr1104 UTSW 2 87021635 missense probably benign 0.00
Z1177:Olfr1104 UTSW 2 87021618 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAAGGACACGATTTGTTACAGAAG -3'
(R):5'- TTAGCCCTGTCCTGTGTAGATG -3'

Sequencing Primer
(F):5'- CACGATTTGTTACAGAAGGTGTTTTC -3'
(R):5'- GCCTTCAGCACGGAATTGGTG -3'
Posted On2019-10-24