Incidental Mutation 'R7610:Ctsk'
ID588535
Institutional Source Beutler Lab
Gene Symbol Ctsk
Ensembl Gene ENSMUSG00000028111
Gene Namecathepsin K
SynonymsCat K, catK
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95499256-95509362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95500844 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 4 (F4L)
Ref Sequence ENSEMBL: ENSMUSP00000015664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015664] [ENSMUST00000090804] [ENSMUST00000107161]
Predicted Effect probably benign
Transcript: ENSMUST00000015664
AA Change: F4L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015664
Gene: ENSMUSG00000028111
AA Change: F4L

DomainStartEndE-ValueType
Inhibitor_I29 26 86 1.48e-22 SMART
Pept_C1 115 328 4.25e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090804
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107161
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of the cathepsin family of cysteine proteases that is highly expressed in osteoclasts and is involved in the degradation of collagen and other matrix proteins in bone. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme. Mice lacking the encoded protein exhibit phenotypic features of pycnodysostosis such as increased bone density and bone deformity, which become progressively more pronounced with age. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene survive well and are fertile. They have osteopetrosis, reduced levels of thyroxine and increased pulmonary fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Ctsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Ctsk APN 3 95501419 missense possibly damaging 0.73
R0255:Ctsk UTSW 3 95508877 missense probably benign 0.00
R0362:Ctsk UTSW 3 95500944 missense probably damaging 1.00
R1241:Ctsk UTSW 3 95500874 missense probably benign
R2014:Ctsk UTSW 3 95506692 missense probably damaging 1.00
R2110:Ctsk UTSW 3 95506677 missense probably benign 0.35
R5597:Ctsk UTSW 3 95501696 missense probably damaging 0.99
R5990:Ctsk UTSW 3 95501456 missense probably damaging 1.00
R6363:Ctsk UTSW 3 95501551 missense probably damaging 1.00
R6754:Ctsk UTSW 3 95502685 missense probably damaging 1.00
R7142:Ctsk UTSW 3 95506948 missense possibly damaging 0.83
R7670:Ctsk UTSW 3 95501614 missense probably benign 0.00
X0005:Ctsk UTSW 3 95500938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTTTGAGTTTATGAATCCCTTAGG -3'
(R):5'- TACATGTGGGAAGCAGACAG -3'

Sequencing Primer
(F):5'- TCCCTTAGGATTAGTGTGTGTG -3'
(R):5'- TGTGGGAAGCAGACAGAAGGAC -3'
Posted On2019-10-24