Incidental Mutation 'R7610:Samd9l'
ID588543
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3376754 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 169 (V169A)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect probably benign
Transcript: ENSMUST00000120087
AA Change: V169A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: V169A

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0398:Samd9l UTSW 6 3374502 missense probably damaging 1.00
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1110:Samd9l UTSW 6 3374267 missense probably benign 0.44
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1268:Samd9l UTSW 6 3376113 missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3376369 missense probably benign 0.06
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4602:Samd9l UTSW 6 3373937 frame shift probably null
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5507:Samd9l UTSW 6 3373898 missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3377247 missense probably benign 0.22
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
R7423:Samd9l UTSW 6 3374408 missense probably damaging 1.00
R7667:Samd9l UTSW 6 3375975 missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3373646 missense probably benign 0.16
R7680:Samd9l UTSW 6 3372569 missense probably damaging 1.00
R7680:Samd9l UTSW 6 3376469 missense probably damaging 1.00
R7814:Samd9l UTSW 6 3374793 missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3374749 missense probably benign 0.00
R8000:Samd9l UTSW 6 3373034 missense probably damaging 1.00
R8098:Samd9l UTSW 6 3375549 missense probably damaging 1.00
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3376770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATTTCCCCGTGTGGTTTG -3'
(R):5'- CCAACAGTGATCATGGTCTCAG -3'

Sequencing Primer
(F):5'- GGTACGTGAATTCATACAAGCTGCTG -3'
(R):5'- TCTCAGGGAGACAGGGC -3'
Posted On2019-10-24