Incidental Mutation 'R7610:Klf14'
ID588544
Institutional Source Beutler Lab
Gene Symbol Klf14
Ensembl Gene ENSMUSG00000073209
Gene NameKruppel-like factor 14
SynonymsBTEB5, 5330411L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30956023-30959078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30958070 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 210 (S210P)
Ref Sequence ENSEMBL: ENSMUSP00000099122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101589]
Predicted Effect probably damaging
Transcript: ENSMUST00000101589
AA Change: S210P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099122
Gene: ENSMUSG00000073209
AA Change: S210P

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
ZnF_C2H2 195 219 1.64e-1 SMART
ZnF_C2H2 225 249 1.98e-4 SMART
ZnF_C2H2 255 277 1.12e-3 SMART
low complexity region 288 301 N/A INTRINSIC
low complexity region 306 316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the Kruppel-like family of transcription factors. The encoded protein functions as a transcriptional co-repressor, and is induced by transforming growth factor-beta (TGF-beta) to repress TGF-beta receptor II gene expression. This gene exhibits imprinted expression from the maternal allele in embryonic and extra-embryonic tissues. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display genome instability and increased tumor incidence with age. Mice homozygous for a conditional allele knocked out in the liver exhibit decreased circulating HDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Klf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4518:Klf14 UTSW 6 30957932 missense possibly damaging 0.77
R4562:Klf14 UTSW 6 30958459 missense probably damaging 1.00
R4771:Klf14 UTSW 6 30958025 missense probably damaging 1.00
R5508:Klf14 UTSW 6 30958042 missense probably damaging 1.00
R5910:Klf14 UTSW 6 30957839 missense probably benign 0.08
R7105:Klf14 UTSW 6 30958541 frame shift probably null
R7595:Klf14 UTSW 6 30958540 missense probably benign 0.26
R8055:Klf14 UTSW 6 30957787 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAGAGAACTGCTTGGGACAC -3'
(R):5'- CTTCTTCGAGGATGAGCTCTC -3'

Sequencing Primer
(F):5'- ACTGCTTGGGACACAGCGG -3'
(R):5'- GAGAGCTCCTGCAGTGATTC -3'
Posted On2019-10-24