Incidental Mutation 'R7610:Zscan18'
ID588546
Institutional Source Beutler Lab
Gene Symbol Zscan18
Ensembl Gene ENSMUSG00000070822
Gene Namezinc finger and SCAN domain containing 18
SynonymsEG232875
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12768090-12803635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12769310 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 774 (K774R)
Ref Sequence ENSEMBL: ENSMUSP00000047088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046245] [ENSMUST00000210650] [ENSMUST00000211392]
Predicted Effect probably damaging
Transcript: ENSMUST00000046245
AA Change: K774R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047088
Gene: ENSMUSG00000070822
AA Change: K774R

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 134 154 N/A INTRINSIC
internal_repeat_2 159 204 6.76e-5 PROSPERO
internal_repeat_1 197 221 2.66e-6 PROSPERO
low complexity region 225 256 N/A INTRINSIC
low complexity region 262 310 N/A INTRINSIC
low complexity region 312 335 N/A INTRINSIC
internal_repeat_1 353 377 2.66e-6 PROSPERO
SCAN 397 509 1.16e-37 SMART
ZnF_C2H2 776 798 2.24e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210650
AA Change: K774R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000210891
Predicted Effect probably damaging
Transcript: ENSMUST00000211392
AA Change: K774R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Other mutations in Zscan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Zscan18 APN 7 12775348 unclassified probably benign
IGL02152:Zscan18 APN 7 12775296 unclassified probably benign
IGL02236:Zscan18 APN 7 12769324 missense probably benign 0.02
IGL02591:Zscan18 APN 7 12775279 unclassified probably benign
IGL02619:Zscan18 APN 7 12774866 unclassified probably benign
IGL02711:Zscan18 APN 7 12775117 unclassified probably benign
IGL03397:Zscan18 APN 7 12773561 missense probably damaging 0.97
R0014:Zscan18 UTSW 7 12769417 missense possibly damaging 0.48
R0465:Zscan18 UTSW 7 12775486 unclassified probably benign
R0548:Zscan18 UTSW 7 12774176 missense probably damaging 1.00
R1506:Zscan18 UTSW 7 12774202 missense probably damaging 1.00
R1725:Zscan18 UTSW 7 12770857 missense probably damaging 1.00
R2323:Zscan18 UTSW 7 12775459 unclassified probably benign
R5034:Zscan18 UTSW 7 12774145 missense probably damaging 1.00
R5180:Zscan18 UTSW 7 12775289 unclassified probably benign
R5579:Zscan18 UTSW 7 12775381 unclassified probably benign
R5635:Zscan18 UTSW 7 12770864 missense probably benign 0.00
R5708:Zscan18 UTSW 7 12774456 missense probably benign 0.01
R6088:Zscan18 UTSW 7 12775198 unclassified probably benign
R6320:Zscan18 UTSW 7 12775220 unclassified probably benign
R7048:Zscan18 UTSW 7 12774744 unclassified probably benign
R7683:Zscan18 UTSW 7 12769605 nonsense probably null
R8287:Zscan18 UTSW 7 12775371 missense unknown
RF055:Zscan18 UTSW 7 12774425 small deletion probably benign
Z1088:Zscan18 UTSW 7 12775067 missense probably benign 0.18
Z1088:Zscan18 UTSW 7 12775093 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCACCAGTGAGTTTTGCTTC -3'
(R):5'- AAAGAGGCCCCATCCAGATG -3'

Sequencing Primer
(F):5'- TTCTGGCAGAGAAGGGCTC -3'
(R):5'- CCCATCCAGATGACGAGGATG -3'
Posted On2019-10-24