Incidental Mutation 'R7610:Ddx25'
ID588551
Institutional Source Beutler Lab
Gene Symbol Ddx25
Ensembl Gene ENSMUSG00000032101
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 25
SynonymsGRTH
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location35536647-35558528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35554597 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 109 (L109F)
Ref Sequence ENSEMBL: ENSMUSP00000034612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034612] [ENSMUST00000034615] [ENSMUST00000121246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034612
AA Change: L109F

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101
AA Change: L109F

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 101 111 N/A INTRINSIC
DEXDc 117 316 1.26e-41 SMART
HELICc 353 440 6.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034615
SMART Domains Protein: ENSMUSP00000034615
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 6.8e-12 PFAM
Pfam:PseudoU_synth_1 213 331 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121246
SMART Domains Protein: ENSMUSP00000113382
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 3e-12 PFAM
Pfam:PseudoU_synth_1 213 316 1.5e-21 PFAM
Meta Mutation Damage Score 0.6062 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The encoded protein is a gonadotropin-regulated and developmentally expressed testicular RNA helicase. It may serve to maintain testicular functions related to steroidogenesis and spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrest of spermatogenesis at step 8, abnormal Leydig cells, and increased germ cell apoptosis in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Ddx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ddx25 APN 9 35543595 splice site probably benign
IGL00951:Ddx25 APN 9 35552835 critical splice donor site probably null
IGL02237:Ddx25 APN 9 35542069 splice site probably benign
IGL02270:Ddx25 APN 9 35554412 splice site probably benign
IGL02273:Ddx25 APN 9 35546826 missense possibly damaging 0.95
IGL02325:Ddx25 APN 9 35554508 unclassified probably benign
IGL02422:Ddx25 APN 9 35551364 missense probably null 1.00
IGL02440:Ddx25 APN 9 35557678 unclassified probably benign
IGL02798:Ddx25 APN 9 35551397 missense probably damaging 1.00
IGL03339:Ddx25 APN 9 35542003 missense probably damaging 1.00
R0633:Ddx25 UTSW 9 35545972 missense probably damaging 0.99
R0893:Ddx25 UTSW 9 35554390 nonsense probably null
R1171:Ddx25 UTSW 9 35546846 nonsense probably null
R1448:Ddx25 UTSW 9 35557738 missense probably benign
R1453:Ddx25 UTSW 9 35542002 missense probably damaging 1.00
R1582:Ddx25 UTSW 9 35545976 missense probably damaging 0.97
R3055:Ddx25 UTSW 9 35551351 missense probably damaging 1.00
R5960:Ddx25 UTSW 9 35554511 splice site probably null
R7425:Ddx25 UTSW 9 35554586 missense probably benign 0.08
R7535:Ddx25 UTSW 9 35543655 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTGGCTCTGTGCTATGAGG -3'
(R):5'- GTGGCTGAGACAACTAACAACG -3'

Sequencing Primer
(F):5'- CTGTGCTATGAGGTTCTGGGGAC -3'
(R):5'- ACGCTCAATTGCAAATGGC -3'
Posted On2019-10-24