Incidental Mutation 'R7610:Grb10'
ID588555
Institutional Source Beutler Lab
Gene Symbol Grb10
Ensembl Gene ENSMUSG00000020176
Gene Namegrowth factor receptor bound protein 10
Synonyms5730571D09Rik, maternally expressed gene 1, Meg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location11930508-12038683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11943955 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 377 (K377R)
Ref Sequence ENSEMBL: ENSMUSP00000091011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093321] [ENSMUST00000109653] [ENSMUST00000109654]
Predicted Effect probably benign
Transcript: ENSMUST00000093321
AA Change: K377R

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091011
Gene: ENSMUSG00000020176
AA Change: K377R

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
PH 294 404 7.13e-10 SMART
Pfam:BPS 427 473 6.4e-31 PFAM
SH2 493 582 7.78e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109653
AA Change: K331R

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105280
Gene: ENSMUSG00000020176
AA Change: K331R

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
Blast:PH 285 358 1e-44 BLAST
Pfam:BPS 381 428 3.5e-33 PFAM
SH2 447 536 7.78e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109654
AA Change: K322R

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105281
Gene: ENSMUSG00000020176
AA Change: K322R

DomainStartEndE-ValueType
RA 114 198 5.45e-24 SMART
PH 239 349 7.13e-10 SMART
Pfam:BPS 372 419 5.4e-33 PFAM
SH2 438 527 7.78e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
PHENOTYPE: Maternal transmission of a mutant allele results in both fetal and placental overgrowth. Disproportionate overgrowth of the liver is observed. Paternal transmission of an allele lacking the differentially methylated region results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Grb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Grb10 APN 11 11945599 missense probably damaging 1.00
IGL01450:Grb10 APN 11 11970432 missense probably damaging 1.00
IGL01872:Grb10 APN 11 11970547 missense probably damaging 0.99
IGL02164:Grb10 APN 11 11943962 missense probably damaging 1.00
IGL02508:Grb10 APN 11 11946767 missense probably damaging 1.00
IGL02626:Grb10 APN 11 11945503 missense probably benign 0.00
IGL03275:Grb10 APN 11 11933591 missense possibly damaging 0.46
virginia UTSW 11 11933551 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0089:Grb10 UTSW 11 11934192 splice site probably benign
R0196:Grb10 UTSW 11 11945583 missense probably damaging 1.00
R0419:Grb10 UTSW 11 11934207 missense possibly damaging 0.87
R0645:Grb10 UTSW 11 11936755 missense probably damaging 0.98
R1473:Grb10 UTSW 11 11934249 missense probably damaging 1.00
R1848:Grb10 UTSW 11 11946029 missense possibly damaging 0.78
R2025:Grb10 UTSW 11 11970576 nonsense probably null
R4455:Grb10 UTSW 11 11967665 missense possibly damaging 0.93
R4857:Grb10 UTSW 11 11951469 unclassified probably benign
R5289:Grb10 UTSW 11 11944924 splice site silent
R5522:Grb10 UTSW 11 11936746 missense probably benign 0.05
R5696:Grb10 UTSW 11 11933566 missense probably benign 0.23
R6119:Grb10 UTSW 11 11933551 missense probably damaging 1.00
R6163:Grb10 UTSW 11 11943932 nonsense probably null
R6267:Grb10 UTSW 11 11970639 start gained probably benign
R6328:Grb10 UTSW 11 11937905 missense probably damaging 1.00
R6741:Grb10 UTSW 11 11936717 critical splice donor site probably null
R7641:Grb10 UTSW 11 11933492 missense possibly damaging 0.84
R8209:Grb10 UTSW 11 11951533 missense probably damaging 0.99
R8226:Grb10 UTSW 11 11951533 missense probably damaging 0.99
Z1176:Grb10 UTSW 11 11944845 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GGTTCTACCCTTTCTGAGATCTTAG -3'
(R):5'- TGAATCTTCATGGATACCTGGGAGG -3'

Sequencing Primer
(F):5'- GTCAGGATAGACCCACAT -3'
(R):5'- CCTGGGAGGTGGTAGCTAGATC -3'
Posted On2019-10-24