Incidental Mutation 'R7610:Smc1b'
ID588564
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Namestructural maintenance of chromosomes 1B
SynonymsSMC1beta, Smc1l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85064689-85131964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85070820 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1077 (D1077G)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023068
AA Change: D1077G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: D1077G

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Meta Mutation Damage Score 0.3847 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85129700 missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85131898 missense probably damaging 1.00
IGL01656:Smc1b APN 15 85114776 missense probably damaging 0.99
IGL01807:Smc1b APN 15 85096745 missense probably damaging 0.97
IGL02094:Smc1b APN 15 85097891 splice site probably benign
IGL02121:Smc1b APN 15 85097985 missense probably benign
IGL02631:Smc1b APN 15 85107003 missense probably damaging 0.98
IGL02678:Smc1b APN 15 85065000 nonsense probably null
IGL03197:Smc1b APN 15 85070863 missense possibly damaging 0.85
IGL03214:Smc1b APN 15 85097946 nonsense probably null
IGL03218:Smc1b APN 15 85089713 missense probably benign 0.07
IGL03232:Smc1b APN 15 85129720 missense possibly damaging 0.68
adamantine UTSW 15 85121641 missense probably benign 0.06
unbreakable UTSW 15 85096658 missense probably benign
E0370:Smc1b UTSW 15 85127581 missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 85069651 missense possibly damaging 0.91
R0092:Smc1b UTSW 15 85067724 unclassified probably benign
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0207:Smc1b UTSW 15 85123759 missense probably benign
R0390:Smc1b UTSW 15 85066277 missense probably damaging 1.00
R0440:Smc1b UTSW 15 85112673 splice site probably benign
R0685:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R1109:Smc1b UTSW 15 85112815 missense probably damaging 0.98
R1392:Smc1b UTSW 15 85107070 splice site probably benign
R1509:Smc1b UTSW 15 85086134 missense probably benign
R1804:Smc1b UTSW 15 85127790 missense possibly damaging 0.90
R1879:Smc1b UTSW 15 85092067 missense probably benign 0.01
R2086:Smc1b UTSW 15 85121851 splice site probably benign
R2143:Smc1b UTSW 15 85123802 missense probably benign
R2158:Smc1b UTSW 15 85121851 splice site probably benign
R2174:Smc1b UTSW 15 85121851 splice site probably benign
R2471:Smc1b UTSW 15 85092017 missense probably damaging 0.98
R3689:Smc1b UTSW 15 85117263 intron probably benign
R3690:Smc1b UTSW 15 85117263 intron probably benign
R4178:Smc1b UTSW 15 85120647 missense possibly damaging 0.94
R4420:Smc1b UTSW 15 85112830 missense probably damaging 1.00
R4905:Smc1b UTSW 15 85066227 missense probably damaging 1.00
R4919:Smc1b UTSW 15 85117104 intron probably benign
R5114:Smc1b UTSW 15 85064984 missense probably damaging 1.00
R5314:Smc1b UTSW 15 85070865 missense probably benign 0.00
R5476:Smc1b UTSW 15 85086151 missense probably damaging 0.97
R5593:Smc1b UTSW 15 85121641 missense probably benign 0.06
R5690:Smc1b UTSW 15 85112773 missense probably damaging 1.00
R5719:Smc1b UTSW 15 85096658 missense probably benign
R5817:Smc1b UTSW 15 85067783 missense probably damaging 0.99
R5834:Smc1b UTSW 15 85089665 missense probably damaging 1.00
R5930:Smc1b UTSW 15 85086121 missense probably damaging 1.00
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85121695 missense probably damaging 1.00
R6306:Smc1b UTSW 15 85127623 missense probably benign 0.30
R6392:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6426:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6435:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6436:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6437:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6508:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6512:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6703:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6737:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6775:Smc1b UTSW 15 85089680 missense probably damaging 0.96
R6889:Smc1b UTSW 15 85067759 missense probably damaging 1.00
R6908:Smc1b UTSW 15 85107010 missense probably damaging 1.00
R7124:Smc1b UTSW 15 85071597 missense probably damaging 0.98
R7400:Smc1b UTSW 15 85069720 missense probably damaging 1.00
R7417:Smc1b UTSW 15 85097542 missense probably benign 0.05
R7873:Smc1b UTSW 15 85110650 critical splice donor site probably null
R7890:Smc1b UTSW 15 85066328 missense probably damaging 1.00
R8004:Smc1b UTSW 15 85097614 missense probably damaging 0.98
Z1176:Smc1b UTSW 15 85131903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCAGTCTTCCTGCACTGG -3'
(R):5'- GCTCTGTCAAGAAAAGATTCATGAAGC -3'

Sequencing Primer
(F):5'- GGCTTTGCACCTATGTTATTAAGGAC -3'
(R):5'- TCATGAAGCTTAAAAGTTGTTTTCTC -3'
Posted On2019-10-24