Incidental Mutation 'R7610:Mgrn1'
ID588565
Institutional Source Beutler Lab
Gene Symbol Mgrn1
Ensembl Gene ENSMUSG00000022517
Gene Namemahogunin, ring finger 1
Synonyms2610042J20Rik, nc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4886249-4938296 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 4934233 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 533 (*533Q)
Ref Sequence ENSEMBL: ENSMUSP00000068314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023159] [ENSMUST00000050881] [ENSMUST00000070658] [ENSMUST00000229038] [ENSMUST00000229961] [ENSMUST00000230931] [ENSMUST00000230990]
Predicted Effect probably benign
Transcript: ENSMUST00000023159
SMART Domains Protein: ENSMUSP00000023159
Gene: ENSMUSG00000022517

DomainStartEndE-ValueType
low complexity region 205 216 N/A INTRINSIC
low complexity region 268 278 N/A INTRINSIC
RING 279 317 4.58e-4 SMART
low complexity region 349 360 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050881
SMART Domains Protein: ENSMUSP00000054201
Gene: ENSMUSG00000022516

DomainStartEndE-ValueType
PDB:3KVH|A 6 210 1e-133 PDB
Predicted Effect probably null
Transcript: ENSMUST00000070658
AA Change: *533Q
SMART Domains Protein: ENSMUSP00000068314
Gene: ENSMUSG00000022517
AA Change: *533Q

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
RING 278 316 4.58e-4 SMART
low complexity region 348 359 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000229038
AA Change: *534Q
Predicted Effect probably benign
Transcript: ENSMUST00000229961
Predicted Effect probably benign
Transcript: ENSMUST00000230931
Predicted Effect probably null
Transcript: ENSMUST00000230990
AA Change: *555Q
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mahogunin (MGRN1) is a C3HC4 RING-containing protein with E3 ubiquitin ligase activity in vitro.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for mutant alleles exhibit darkening of agouti hair and suppression of the obesity associated with certain agouti mutations. Homozygotes for an induced null mutation also have curly whiskers and develop a progressive spongiform neuropathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Mgrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mgrn1 APN 16 4916155 critical splice donor site probably null
IGL02175:Mgrn1 APN 16 4920368 missense probably benign 0.02
IGL02382:Mgrn1 APN 16 4922618 missense probably damaging 0.97
R1204:Mgrn1 UTSW 16 4907409 missense probably damaging 1.00
R1515:Mgrn1 UTSW 16 4915780 missense probably benign 0.11
R1625:Mgrn1 UTSW 16 4910763 missense probably damaging 1.00
R2875:Mgrn1 UTSW 16 4907416 missense possibly damaging 0.85
R4928:Mgrn1 UTSW 16 4927862 missense probably benign 0.29
R4955:Mgrn1 UTSW 16 4934219 missense probably benign 0.00
R6085:Mgrn1 UTSW 16 4920376 missense probably benign 0.01
R6189:Mgrn1 UTSW 16 4910810 critical splice donor site probably null
R7095:Mgrn1 UTSW 16 4927664 splice site probably null
R7293:Mgrn1 UTSW 16 4932220 missense probably benign 0.01
R8187:Mgrn1 UTSW 16 4920365 missense probably benign 0.02
R8376:Mgrn1 UTSW 16 4915766 missense probably damaging 1.00
Z1177:Mgrn1 UTSW 16 4922724 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTTACTGTCACACATACACACGTC -3'
(R):5'- TAGACCCTCTGGCTCCAAAG -3'

Sequencing Primer
(F):5'- ACACGTCTCTCTCTTGGTTAGAAAGG -3'
(R):5'- GCTCCAAAGTCAGGAATGGC -3'
Posted On2019-10-24