Incidental Mutation 'R7610:Pgm5'
ID588570
Institutional Source Beutler Lab
Gene Symbol Pgm5
Ensembl Gene ENSMUSG00000041731
Gene Namephosphoglucomutase 5
Synonyms9530034F03Rik, aciculin
MMRRC Submission
Accession Numbers

Genbank: NM_175013

Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location24683016-24861855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24834756 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 137 (N137K)
Ref Sequence ENSEMBL: ENSMUSP00000036025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047666]
Predicted Effect probably damaging
Transcript: ENSMUST00000047666
AA Change: N137K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036025
Gene: ENSMUSG00000041731
AA Change: N137K

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 19 163 3.9e-31 PFAM
Pfam:PGM_PMM_II 198 306 1.8e-15 PFAM
Pfam:PGM_PMM_III 311 425 6.9e-31 PFAM
SCOP:d3pmga4 427 567 5e-74 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoglucomutases (EC 5.2.2.2.), such as PGM5, are phosphotransferases involved in interconversion of glucose-1-phosphate and glucose-6-phosphate. PGM activity is essential in formation of carbohydrates from glucose-6-phosphate and in formation of glucose-6-phosphate from galactose and glycogen (Edwards et al., 1995 [PubMed 8586438]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Pgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Pgm5 APN 19 24834766 missense possibly damaging 0.65
IGL01318:Pgm5 APN 19 24816478 missense probably damaging 1.00
IGL01372:Pgm5 APN 19 24733621 missense probably damaging 1.00
IGL01541:Pgm5 APN 19 24816413 missense probably damaging 1.00
IGL01648:Pgm5 APN 19 24824351 missense probably damaging 0.99
IGL02049:Pgm5 APN 19 24824418 missense probably benign 0.00
IGL02827:Pgm5 APN 19 24709295 missense probably benign 0.16
IGL02975:Pgm5 APN 19 24834848 missense probably benign 0.00
3-1:Pgm5 UTSW 19 24727788 missense probably benign 0.02
P0047:Pgm5 UTSW 19 24816421 missense probably damaging 1.00
PIT4466001:Pgm5 UTSW 19 24824329 missense probably damaging 1.00
R0013:Pgm5 UTSW 19 24733540 critical splice donor site probably null
R0047:Pgm5 UTSW 19 24684556 missense probably damaging 0.98
R0180:Pgm5 UTSW 19 24815763 missense probably damaging 1.00
R0317:Pgm5 UTSW 19 24824399 missense possibly damaging 0.55
R0478:Pgm5 UTSW 19 24834869 missense possibly damaging 0.45
R1587:Pgm5 UTSW 19 24815749 missense probably damaging 1.00
R2017:Pgm5 UTSW 19 24824312 missense probably benign 0.06
R2087:Pgm5 UTSW 19 24733563 missense probably damaging 0.99
R2152:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R2169:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R3851:Pgm5 UTSW 19 24820203 missense probably damaging 1.00
R4034:Pgm5 UTSW 19 24861657 missense probably damaging 0.96
R4489:Pgm5 UTSW 19 24816445 missense probably benign 0.12
R4630:Pgm5 UTSW 19 24834746 nonsense probably null
R4736:Pgm5 UTSW 19 24834805 missense probably damaging 1.00
R5186:Pgm5 UTSW 19 24820128 missense probably damaging 1.00
R5414:Pgm5 UTSW 19 24709325 missense probably damaging 0.99
R5558:Pgm5 UTSW 19 24824451 splice site probably null
R5617:Pgm5 UTSW 19 24750401 nonsense probably null
R6142:Pgm5 UTSW 19 24824408 missense probably damaging 1.00
R6648:Pgm5 UTSW 19 24861632 missense probably benign 0.02
R6821:Pgm5 UTSW 19 24861647 missense possibly damaging 0.88
R7360:Pgm5 UTSW 19 24834817 missense probably damaging 1.00
R7421:Pgm5 UTSW 19 24709299 missense probably benign 0.03
R7590:Pgm5 UTSW 19 24709265 missense probably damaging 1.00
R7685:Pgm5 UTSW 19 24727851 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GATCAAGAGACTAGCCCTGTG -3'
(R):5'- TGCCTTCAAGTCCATGAACC -3'

Sequencing Primer
(F):5'- AAGAGACTAGCCCTGTGCATCTG -3'
(R):5'- GCAGTCTCCTGCATTATC -3'
Posted On2019-10-24